A helicopter is flying from Hong Kong to Jakarta. The latitude of Jakarta is -6.20°, and its longitude is 106.80°. The latitude of Hong Kong is 22.27°, and its longitude is 114.15°. What is the helicopter’s net change in latitude and longitude as it travels from Hong Kong to Jakarta?

Answers

Answer 1

The net Change in latitude and longitude of the helicopter are; 28.47° and 7.35° respectively.

What is the net Change in latitude and longitude of the helicopter?

The net change in latitude of the helicopter can be evaluated as follows;

x = |-6.20° - 22.27°| = |-28.47°|

x = 28.47°

The net change in longitude of the helicopter can be evaluated similarly as follows;

y = |106.80° - 114.15°| = |-7.35°|

x= 7.35°

Read more on longitude and latitude;

https://brainly.com/question/1939015

#SPJ1


Related Questions

To attend a Baseball game, a family of 2 adults and 4 kids pays $70. 90. Another group 7 adults and 3 kids attend the same game and pay


$139. 80.


Write a system of equations that can model this situation.


Let a = cost of one adult ticket and k = the cost of one kid ticket.

Answers

The system of equations that can model this situation is:2a + 4k = 70.907a + 3k = 139.80

Let a = the cost of one adult ticket and k = the cost of one kid ticket. To write a system of equations that can model the given situation, consider the following steps:

Step 1: Write an equation for the first group that paid $70.90.We know that the first group consists of 2 adults and 4 kids. Therefore, the total cost for the first group can be expressed as:2a + 4k = 70.90This equation represents the cost of 2 adult tickets and 4 kid tickets.

Step 2: Write an equation for the second group that paid $139.80.We know that the second group consists of 7 adults and 3 kids. Therefore, the total cost for the second group can be expressed as:7a + 3k = 139.80.This equation represents the cost of 7 adult tickets and 3 kid tickets.

Know more about equation here:

https://brainly.com/question/28606484

#SPJ11

The height of a cylindrical drum of water is 10 cm and the diameter is 14cm. Find the volume of the drum​

Answers

The volume of a cylinder can be calculated using the formula:

V = πr^2h

where V is the volume, r is the radius, and h is the height.

First, we need to find the radius of the drum. The diameter is given as 14 cm, so the radius is half of that, or 7 cm.

Now we can plug in the values:

V = π(7 cm)^2(10 cm)

V = π(49 cm^2)(10 cm)

V = 1,539.38 cm^3 (rounded to two decimal places)

Therefore, the volume of the cylindrical drum of water is approximately 1,539.38 cubic centimeters.

what is the average throughput (in terms of mss and rt t) for this connection up through time = 5 rt t?

Answers

The average throughput for this connection up through time = 5 RTT can be calculated using the formula: (N * MSS) / (5 * RTT).

To calculate the average throughput for this connection up through time = 5 RTT (round-trip time), you will need to follow these steps:

1. Determine the MSS (maximum segment size) and RTT for the connection. Since these values are not provided, I will use placeholders: MSS = X and RTT = Y.

2. Calculate the total time taken for the connection up through time = 5 RTT. In this case, the total time is 5 * Y, where Y is the RTT.

3. Determine the total amount of data transferred during this time. This would require information about the connection and the number of segments transmitted. Let's assume the connection transferred N segments during the 5 RTT period.

4. Calculate the total data transferred in terms of MSS. This is done by multiplying the number of segments (N) by the MSS (X): Total data = N * X.

5. Finally, calculate the average throughput by dividing the total data transferred by the total time taken: Average Throughput = (N * X) / (5 * Y).

In summary, the average throughput for this connection up through time = 5 RTT can be calculated using the formula: (N * MSS) / (5 * RTT).

Learn more about average throughput:

https://brainly.com/question/30745255

#SPJ11

The base of the pyramid is


a square with side lengths of


30 inches. The height of the


pyramid is 50 inches. Find the


slant height

Answers

The slant height of a pyramid is the height of the pyramid from the base up to the top of the pyramid, measured perpendicular to the base. To find the slant height of a pyramid, we need to know the base and the height of the pyramid.

In this case, the base of the pyramid is a square with side lengths of 30 inches. The height of the pyramid is 50 inches. To find the slant height, we can use the formula:

slant height = (height / 2) / tan(π/4)

where π is approximately equal to 3.14159.

Substituting the given values into the formula, we get:

slant height = (50 / 2) / tan(π/4)

= 25 / tan(π/4)

= 25 / 0.7853981633974483

≈ 32.85 inches

Therefore, the slant height of the pyramid is approximately 32.85 inches

Learn more about pyramind visit: brainly.com/question/218706

#SPJ11

A ball is tossed directly upward with an initial velocity of 120 feet per second. How many seconds will it take for the flare to return to the sea (solve by factoring)

Answers

To determine the time it will take for the ball to return to the ground, we need to find the time when the ball reaches its maximum height and then double that time.

Given:

Initial velocity (u) = 120 feet per second

Acceleration due to gravity (g) = -32 feet per second squared (negative because it acts downward)

The equation of motion for the ball's height (h) as a function of time (t) can be expressed as:

h(t) = ut + (1/2)gt^2

When the ball reaches its maximum height, its vertical velocity (v) becomes 0. We can use this information to find the time it takes to reach the maximum height.

v = u + gt

0 = 120 - 32t

32t = 120

t = 120 / 32

t ≈ 3.75 seconds

The ball takes approximately 3.75 seconds to reach its maximum height. To find the total time of flight, we double this value:

Total time = 2 * 3.75

Total time ≈ 7.5 seconds

Therefore, it will take approximately 7.5 seconds for the ball to return to the ground.

PLSSS HELP IF YOU TRULY KNOW THISSS

Answers

Answer: 1/50

Step-by-step explanation:

Step 1: We need to multiply the numerator and denominator by 100 since there are 2 digits after the decimal.

0.02 = (0.02 × 100) / 100

= 2 / 100 [ since 0.02 × 100 = 2 ]

Step 2: Reduce the obtained fraction to the lowest term

Since 2 is the common factor of 2 and 100 so we divide both the numerator and denominator by 2.

2/100 = (2 ÷ 2) / (100 ÷ 2) = 1/50

Let S denote the triangle with vertices (1,0,0), (0,2,0) and (0,1,1). The density of the surface at the point (x, y, z) is xyz. Then the total mass of this surface is

Answers

The total mass of the surface S with density given by xyz is (2√6/15).

To find the total mass of the surface S with density given by xyz, we need to evaluate the surface integral:

M = ∫∫S xyz dS

where dS is the surface area element.

We can parameterize the surface S using two variables u and v:

r(u, v) = (1 - u - v) (1, 0, 0) + u (0, 2, 0) + v (0, 1, 1)

where 0 ≤ u, v ≤ 1 and u + v ≤ 1.

The normal vector to the surface S at the point r(u, v) is given by the cross product of the partial derivatives of r with respect to u and v:

N(u, v) = ∂r/∂u × ∂r/∂v = (-2, 1, 2)

The magnitude of the normal vector is:

|N(u, v)| = √(2² + 1² + 2²) = √9 = 3

So the unit normal vector to the surface is:

n(u, v) = N(u, v) / |N(u, v)| = (-2/3, 1/3, 2/3)

The surface area element dS can be computed as the magnitude of the cross product of the partial derivatives of r with respect to u and v:

dS = |∂r/∂u × ∂r/∂v| du dv

= |(0, -2, 2) x (-1, 2, 1)| du dv

= |-4i - 2j - 4k| du dv

= 2√6 du dv

So the surface integral for the total mass becomes:

M = ∫∫S xyz dS = ∫0¹ ∫0(1-u) (x(u,v) y(u,v) z(u,v)) (2√6) dv du

where x(u,v) = 1 - u - v, y(u,v) = 2u, and z(u,v) = v.

Substituting these expressions into the integral, we get:

M = ∫0¹ ∫0(1-u) (1 - u - v)(2u)(v)(2√6) dv du

M = (4√6/3) ∫0¹ ∫0(1-u) (u - u² - uv)(v) dv du

M = (4√6/3) ∫0¹ [(u³/3) - (u⁴/4) - (u³/6) + (u⁴/4)] du

M = (4√6/3) ∫0¹ [(u⁴/4) - (u³/4)] du

M = (4√6/3) [(1/20) - (1/16)]

M = (2√6/15)

For more about density:

https://brainly.com/question/9215083

#SPJ4

what is the probability of committing a type i error when = 100? in general, what can be said about the probability of a type i error when the actual value of is less than 0 ?

Answers

The probability of a Type I error is determined by the chosen significance level (α) and does not change based on the actual value being less than a specified threshold.

The probability of committing a Type I error is denoted by α (alpha), also known as the significance level. A Type I error occurs when you reject a null hypothesis when it is actually true. The value of α is set before conducting a hypothesis test and is typically set at 0.05 or 0.01, depending on the desired level of confidence.
In your question, it seems there might be some missing information. The symbol "=" and "100" are unclear, and the term "0" seems incomplete. However, I can provide a general idea about the probability of a Type I error when the actual value is less than a specified threshold.
When the actual value is less than the specified threshold, it means the null hypothesis is true. In this case, the probability of committing a Type I error remains the same as the predetermined significance level (α). This is because the probability of a Type I error is defined as the likelihood of rejecting a true null hypothesis, and it does not depend on the specific values of the test statistic.
In summary, the probability of a Type I error is determined by the chosen significance level (α) and does not change based on the actual value being less than a specified threshold.

To know more about probability visit :

https://brainly.com/question/29221515

#SPJ11

Suppose that a jury pool consists of 27 people, 14 of which are men and 13 of which are women. (a) If the jury must consist of 6 men and 6 women, how many different juries are possible? (b) Again suppose that the jury must consist of 6 men and 6 women. Suppose too that the jurors must be seated so that no two people of the same sex are seated next to each other. How many different seating arrangements are possible? (Note that I’m not saying that we know which men and women are on the jury at first. You need to count the number for each possible jury seating for each possible jury.)

Answers

There are 5,040 different seating arrangements possible.

(a) To find the number of different juries possible, we can use the combination formula. We want to choose 6 men out of 14 and 6 women out of 13, so we have:

C(14, 6) x C(13, 6) = 1,352,697,600

Therefore, there are 1,352,697,600 different juries possible.

(b) To find the number of different seating arrangements possible, we can use the permutation formula. We know that we need to seat the jurors so that no two people of the same sex are seated next to each other. Let's start with the men - we have 6 men to seat, and they cannot be seated next to each other. We can think of this as creating "gaps" for the men to sit in. For example, if we have 6 men, we would need 7 gaps: _ M _ M _ M _ M _ M _ (where the underscores represent the gaps). Then we can choose which gaps the men will sit in, which we can do using the combination formula. We have 7 gaps to choose from, and we need to choose 6 of them for the men to sit in. Therefore, we have:

C(7, 6) = 7

Now we can seat the women in the gaps between the men. We have 6 women to seat, and we have 7 gaps for them to sit in (including the gaps at the ends). We can think of this as arranging the women and gaps in a line:

_ M _ M _ M _ M _ M _

We need to choose which 6 of the 7 gaps the women will sit in, and then arrange the women in those gaps. We can choose the gaps using the combination formula, and then arrange the women in those gaps using the permutation formula. Therefore, we have:

C(7, 6) x P(6, 6) = 7 x 720 = 5,040

Therefore, there are 5,040 different seating arrangements possible.

To know more about  arrangements refer here

https://brainly.com/question/28406752#

#SPJ11

The equation of a circle is 3x²+3y²-7x-6y-3=0. Find the lenght of it's diameter

Answers

To find the length of the diameter of a circle, first rewrite the equation in the standard form of a circle equation, which is (x - h)² + (y - k)² = r², where (h, k) is the center of the circle and r is the radius.

To rewrite the given equation, we complete the square for both the x and y terms.

Starting with 3x² - 7x + 3y² - 6y - 3 = 0, we group the x and y terms separately and complete the square:

3x² - 7x + 3y² - 6y - 3 = (3x² - 7x) + (3y² - 6y) - 3 = 3(x² - (7/3)x) + 3(y² - 2y) - 3.

To complete the square, we need to add the square of half the coefficient of x and y, respectively, to both sides of the equation:

3(x² - (7/3)x + (7/6)²) + 3(y² - 2y + 1²) - 3 = 3(x - 7/6)² + 3(y - 1)² - 3 + 3(49/36) + 3 = 3(x - 7/6)² + 3(y - 1)² + 24/36.

Simplifying further, we have:

3(x - 7/6)² + 3(y - 1)² = 1.

Comparing this equation with the standard form (x - h)² + (y - k)² = r², we can see that the center of the circle is (7/6, 1) and the radius is √(1/3) = 1/√3.

The diameter of a circle is twice the radius, so the length of the diameter is 2 * (1/√3) = 2/√3 * (√3/√3) = 2√3/3.

Therefore, the length of the diameter of the circle is 2√3/3.

Learn more about standard form here:

https://brainly.com/question/17264364

#SPJ11


18% commission
on a $500 couch
pls do step by step

Answers

Answer:

90$

Step-by-step explanation:

1. Find out what the question is asking

18% commission on a 500$ couch means that someone gets 18% of the money when the couch is sold.

2. So now we have to find how much 18% of 500$ is

18% can also be written as 0.18(To find a percentage of any number, simply just multiply the converted percent, in this case, 0.18, and the number you want to find the percent of, in this case, 500.So we do 0.18 x 500 and we get 90

3. In conclusion, 18% commission of 500$ is 90$

1) What AREA formula will you need to use for each of the faces and base of this shape?

2) SHOW YOUR WORK to find the SURFACE AREA of this shape.

Answers

1. The area formula to use for each of the faces and base is the area of triangle

2. The surface area is 139.5 square yards

1) The area formula to use for each of the faces and base

From the question, we have the following parameters that can be used in our computation:

The triangular pyramid

The above means that

The faces and the base of the figure are triangles

So, the area formula to use for each of the faces and base is the area of triangle formula

2) Finding the surface area of the shape.

This is the sum of the areas of the shapes

So, we have

Surface area = 3 * 1/2 * 9 * 8 + 1/2 * 7 * 9

Evaluate

Surface area = 139.5

Hence, the surface area is 139.5 square yards

Read more about surface area at

https://brainly.com/question/26403859

#SPJ1

Each bag of marbles from Lashonda's Marble Company contains 8 orange marbles for every 5 red marbles. If a bag has 45 red marbles, how many orange marbles does it contain?

Answers

To find out how many orange marbles are there in a bag containing 45 red marbles, given that each bag of marbles from Lashonda's Marble Company contains 8 orange marbles for every 5 red marbles, which is 72.

we can use the following steps:

Step 1: Determine the ratio of orange to red marbles in a bag from the given information. Each bag contains 8 orange marbles for every 5 red marbles. So the ratio of orange marbles to red marbles is 8:5. This means for every 8 orange marbles there are 5 red marbles. Therefore, the ratio of red marbles to orange marbles is 5:8

Step 2: Use the ratio of red to orange marbles to find how many orange marbles there are in a bag containing 45 red marbles. We can set up a proportion using the ratio of red marbles to orange marbles:5:8 = 45:xwhere x represents the number of orange marbles in the bag.Cross-multiplying, we get:5x = 8 × 45Simplifying:5x = 360Dividing both sides by 5:x = 72Therefore, a bag containing 45 red marbles has 72 orange marbles. Answer: 72.

to know more ratio,visit:

https://brainly.com/question/19257327

#SPJ11

One of the best things about fall in North Carolina is the NC State Faint This year the ticket


prices are as follows:


Adult ages 13-64 $10/ticket


Child ages 6-12 $5/ticket


Child ages 5 and under free


Senior Adult ages 65+ free


19. ) Write a piecewise function to represent the cost of tickets at the NC State Fair.

Answers

The cost of tickets at the NC State Fair can be represented by a piecewise function that considers different age groups and their corresponding ticket prices.

Let's define a piecewise function, C(x), where x represents the age of the individual. The function will return the cost of the ticket for each age group. Here's the breakdown:

For adults aged 13-64, the ticket price is $10.

Therefore, for 13 ≤ x ≤ 64, C(x) = $10.

For children aged 6-12, the ticket price is $5.

Thus, for 6 ≤ x ≤ 12, C(x) = $5.

Children aged 5 and under can enter the fair for free.

Hence, for x ≤ 5, C(x) = $0.

Senior adults aged 65 and above also receive free admission.

Therefore, for x ≥ 65, C(x) = $0.

By using this piecewise function, you can easily determine the cost of tickets at the NC State Fair based on the age group of the individual attending.

For example, if someone is 25 years old, the cost of their ticket would be C(25) = $10.

Similarly, a 7-year-old child would have a ticket cost of C(7) = $5.

To learn more about cost of tickets visit:

brainly.com/question/23579483

#SPJ11

y= rental charge ($)
x=time (hour)

Answers

The rental charge, denoted as "y," is determined based on the duration of time, denoted as "x," for which the item or service is rented. Factors such as costs, demand, competition, and desired profit margins influence the specific pricing structure.

The rental charge, denoted as "y," is determined based on the amount of time, denoted as "x," that the item or service is rented for. The longer the duration of rental, the higher the rental charge tends to be. The specific pricing structure for rental charges varies depending on the industry, location, and specific rental service being provided.

Rental charges are typically set by the rental company or service provider and can be influenced by several factors. These factors may include the cost of acquiring and maintaining the rental item, overhead expenses such as storage or transportation costs, demand and market conditions, competition, and desired profit margins.

For example, in the context of car rentals, the rental charge may be based on a fixed rate per hour or may involve different rates for specific time increments (e.g., hourly, daily, weekly). Additionally, there may be additional fees or surcharges based on factors such as mileage, fuel usage, insurance coverage, or any optional extras chosen by the customer.

It's important to note that rental charges can vary significantly across different industries and types of rental services. For instance, the rental charges for equipment rentals, housing rentals, or event space rentals may have different pricing structures and factors influencing the overall cost.

Ultimately, the rental charge is determined by considering various factors that contribute to the cost of providing the rental service and the duration of time for which the item or service is rented.

for such more question on rental charge

https://brainly.com/question/12719729

#SPJ11

the joint probability density function of x and y is given by f(x,y)={x y8,0,0

Answers

The probability that x is less than 0.5 and y is greater than 0.6 is 0.0087.

The given joint probability density function of x and y is:

f(x,y) = {

x × y^8, 0 <= x <= 1, 0 <= y <= 1,

0, elsewhere

}

To determine the marginal probability density function of x, we integrate the joint probability density function over the y-axis:

f(x) = [tex]\int [0,1] x\times y^8 dy[/tex]

=[tex]x \times [y^{9/9}]_{[0,1]}[/tex]

= x/9

Similarly, to determine the marginal probability density function of y, we integrate the joint probability density function over the x-axis:

f(y) = [tex]\int[0,1] x \times y^8 dx[/tex]

= [tex]y^8 \times [x^{2/2}] _{[0,1]}[/tex]

= [tex]y^{8/2}[/tex]

To determine the probability that x is less than 0.5 and y is greater than 0.6, we use the joint probability density function and integrate over the given region:

P(x < 0.5 and y > 0.6) = [tex]\int[0.6,1] \int[0,0.5] x\times y^8 dx dy[/tex]

= [tex]\int[0.6,1] y^{8/2} \times [x^{2/2}][0,0.5] dy[/tex]

= [tex]\int[0.6,1] y^{8/16} dy[/tex]

= [tex][y^9/144][0.6,1][/tex]

= 0.0087

For similar questions on probability

https://brainly.com/question/13604758

#SPJ11

The probability that x is less than 0.5 and y is greater than 0.6 is approximately 0.00011.

To determine the probability that x is less than 0.5 and y is greater than 0.6, we need to integrate the joint probability density function over the specified region.

Given the joint probability density function:

f(x, y) = {

x × y^8, 0 ≤ x ≤ 1, 0 ≤ y ≤ 1,

0, elsewhere

}

To find the probability, we integrate the joint density function over the region:

P(x < 0.5 and y > 0.6) = ∫∫R f(x, y) dxdy

= ∫[0,0.5] ∫[0.6,1] (x × y^8) dy dx

= ∫[0,0.5] [((x × y^9)/9) |_0.6^1] dx

= ∫[0,0.5] (x/9 - (0.6^9 × x)/9) dx

= [(x^2)/18 - (0.6^9 × x^2)/18] |_0^0.5

= [(0.5^2)/18 - (0.6^9 × 0.5^2)/18] - [0 - 0]

= (1/72 - (0.6^9)/18) ≈ 0.00011

To learn more about probability  click here

brainly.com/question/30034780

#SPJ11

Please help, Algebra 1 Question, Easy

Answers

The simplified expression is [tex]-9z^32 + 3x^7y^4 / (z^5y^2).[/tex]

How to simplify the expression

To simplify the expression [tex](36z^6^7 - 12x^7y^4) / (-4z^5y^2),[/tex] we can apply the rules of exponents and divide each term in the numerator by the denominator:

[tex](36z^6^7 - 12x^7y^4) / (-4z^5y^2)[/tex]

First, let's simplify the numerator: [tex]36z^6^7 - 12x^7y^4.[/tex]

Using the power of a power rule, we can simplify [tex]z^6^7 to z^(6*7) = z^42[/tex].

Therefore, the numerator becomes: [tex]36z^42 - 12x^7y^4.[/tex]

Now, we can divide each term in the numerator by the denominator:

[tex](36z^42 - 12x^7y^4) / (-4z^5y^2)[/tex]

= [tex]-36z^(42-5) / (4z^5) + 12x^7y^4 / (4z^5y^2)[/tex]

=[tex]-9z^37 / z^5 + 3x^7y^4 / (z^5y^2)[/tex]

Using the quotient rule of exponents, we subtract the exponents when dividing like bases:

= [tex]-9z^(37-5) + 3x^7y^4 / (z^5y^2)[/tex]

= -9z^32 + 3x^7y^4 / (z^5y^2)

Therefore, the simplified expression is [tex]-9z^32 + 3x^7y^4 / (z^5y^2).[/tex]

Learn more about expression at https://brainly.com/question/1859113

#SPJ1

Complete the equivalent ratio table pls help

Answers

The equivalent ratio table can be expressed as  

table 1;

The arrangement will be 7, 21 , 35 , 63

                                          3 , 9 , 15 , 27

Table 2;

The arrangement will be 5 ,10 , 25, 35

                                          9, 18, 27 , 63

Table 3;

The arrangement will be 10 , 20, 50 , 70

                                          13 , 26, 65, 91

Table 4;

The arrangement will be 11 , 22 ,44 , 88

                                          2 , 4  , 8 ,  16

How can the equivalent ratio table be formed?

From the table 1 we will need to multiply the first term of the first role and the second role by 3, 5 9 to complete the role.

From the table 2 we will need to multiply the first term of the first role and the second role by 2, 5 , 7 to complete the role.

From the table 3 we will need to multiply the first term of the first role and the second role by 2, 5, 7 to complete the role.

From the table4 we will need to multiply the first term of the first role and the second role by 2 , 4 , 8 to complete the role.

Learn more about equivalent ratio at:

https://brainly.com/question/2914376

#SPJ1

: C. For the above part B d), we are actually using simulation to approximate Ppk 30, n pk X~Bin(n 50, p 0.4) can be approximated by Normal distribution with mean u n p = _ Use this approximation fact, please calculate and variance o2 = n*p*(1-p) = P(Pk

Answers

To approximate Ppk for the given binomial distribution X~Bin(n=50, p=0.4), we can use the Normal distribution with mean µ = n*p and variance σ² = n*p*(1-p).

The mean µ = 50 * 0.4 = 20.
The variance σ² = 50 * 0.4 * (1-0.4) = 12.

Using the Normal approximation, we have approximated the binomial distribution X~Bin(50, 0.4) with a Normal distribution with mean µ = 20 and variance σ² = 12.

For a more detailed explanation, when the sample size (n) is large, and the probability (p) is not too close to 0 or 1, the binomial distribution can be approximated by a normal distribution. In this case, the normal approximation simplifies calculations and provides a good estimate for the binomial probability P(pk).

To know more about binomial distribution click on below link:

https://brainly.com/question/29163389#

#SPJ11

Hal learns the folowing a falcon travels about 0. 3 kilometers in 10 seconds a worm travels about 2 centimeters in 10 seconds about how much farther can a falcon travel than a worm in 10 seconds

Answers

A falcon can travel 29,998 centimeters farther than a worm in 10 seconds.

Hal learns that a falcon travels about 0.3 kilometers in 10 seconds, and a worm travels about 2 centimeters in 10 seconds. To determine how much farther a falcon can travel than a worm in 10 seconds, we need to convert the distance traveled by the falcon from kilometers to centimeters.1 kilometer = 100,000 centimeters. So, 0.3 kilometers = 0.3 x 100,000 = 30,000 centimeters. Therefore, a falcon travels 30,000 centimeters in 10 seconds .A worm travels 2 centimeters in 10 seconds. To find out how much farther the falcon travels than the worm in 10 seconds, we need to subtract the distance the worm travels from the distance the falcon travels.30,000 - 2 = 29,998

Know more about distance here:

https://brainly.com/question/1447019

#SPJ11

Account A has a simple annual interest rate of 3% and account B has a
simple annual interest rate of 3.5%. How much more interest do you earn
per year when you deposit x dollars in account B instead of account A?

Answers

The difference in interest earned per year when depositing x dollars in account B instead of account A is 0.005x dollars.

To calculate the difference in interest earned per year between account B and account A, we need to consider the interest rates of both accounts and the initial deposit amount.

Let's assume the initial deposit amount is x dollars.

For account A, with a simple annual interest rate of 3%, the interest earned per year can be calculated as:

Interest_A = (3/100) * x = 0.03x dollars

For account B, with a simple annual interest rate of 3.5%, the interest earned per year can be calculated as:Interest_B = (3.5/100) * x = 0.035x dollars

To find the difference in interest earned per year, we subtract the interest earned in account A from the interest earned in account B:

Difference = Interest_B - Interest_A = 0.035x - 0.03x = 0.005x dollars

Therefore, the difference in interest earned per year when depositing x dollars in account B instead of account A is 0.005x dollars.

This means that for each dollar deposited, account B earns an additional 0.005 dollars of interest compared to account A per year.

It's important to note that this calculation assumes simple interest and doesn't take into account compounding or any other fees or factors that may affect the actual interest earned.

For more question on interest visit:

https://brainly.com/question/25720319

#SPJ8

Sue has a monopoly over the production of strawberry shortcake. Her cost function is C(y) = y^2 + 10y. The market demand curve for strawberry shortcakes is p(y) = 100 - (1/2)y.
a) What is Sue's profit-maximizing level of output y*?
b) What is the price p* at this level of output?
c) Calculate her profit (pi)*
d) Find the consumers' surplus at p* and y*

Answers

Profit-maximizing refers to the level of output or production at which a business or a firm achieves the highest possible profit.

a) To find Sue's profit-maximizing level of output, we need to find the quantity where marginal revenue equals marginal cost. Marginal revenue is the derivative of the demand function, which is MR(y) = 100 - y/2. Marginal cost is the derivative of the cost function, which is MC(y) = 2y + 10. Setting MR(y) equal to MC(y) and solving for y, we get:

100 - y/2 = 2y + 10

90 = 5/2 y

y* = 36

So Sue's profit-maximizing level of output is 36.

b) To find the price at this level of output, we substitute y* into the demand function:

p* = 100 - (1/2)(36)

p* = $82

So the price at this level of output is $82.

c) To find Sue's profit, we need to subtract her total cost from her total revenue. Total revenue is price times quantity, or TR(y*) = p(y*) * y*:

TR(y*) = $82 * 36 = $2,952

Total cost is C(y*) = y*^2 + 10y*:

C(y*) = 36^2 + 10(36) = $1,296

So Sue's profit is:

(pi)* = TR(y*) - C(y*) = $2,952 - $1,296 = $1,656

So Sue's profit is $1,656.

d) Consumer surplus is the difference between the total value consumers place on a good and the amount they actually pay for it. At the profit-maximizing price and quantity, consumer surplus is:

CS = (1/2)(p* - MC(y*)) * y*

CS = (1/2)($82 - [2(36) + 10]) * 36

CS = $198

So the consumer surplus at the profit-maximizing price and quantity is $198.

To learn more about derivative visit:

brainly.com/question/30365299

#SPJ11

the z-value for a standard normal distribution ________. a. is always positive b. is always equal to zero c. can be either positive or negative d. is always equal to the value of the population mean

Answers

The correct answer is:

c. The z-value for a standard normal distribution can be either positive or negative.

The z-value, also known as the standard score, measures the distance between a data point and the mean of its distribution in units of standard deviation. It is calculated by subtracting the population mean from the data point and then dividing the result by the standard deviation.

Since the mean of a standard normal distribution is zero, the z-value simply represents the number of standard deviations a data point is from the mean. As a result, the z-value can be either positive or negative, depending on whether the data point is above or below the mean, respectively.

To learn more about z-value refer below

https://brainly.com/question/7207785

#SPJ11

calculate the area of the region between the two curves =2 and =2 6.

Answers

The area between the curves y = x^2 and y = 2x - 6 is 14.67 square units.

What is the measure of the area enclosed by the curves y = x^2 and y = 2x - 6?

The region between the curves y = x^2 and y = 2x - 6 can be calculated by finding the points of intersection between the two curves. To determine these points, we equate the equations: x^2 = 2x - 6. By rearranging the equation, we get x^2 - 2x + 6 = 0. Solving this quadratic equation yields two real solutions: x = -1 and x = 3. These values represent the x-coordinates of the intersection points.

To calculate the area, we integrate the difference between the two curves within the given interval. The area A can be expressed as A = ∫[a,b] (f(x) - g(x)) dx, where f(x) represents the upper curve and g(x) represents the lower curve. In this case, A = ∫[-1,3] (2x - 6 - x^2) dx.

Evaluating this integral yields the area between the curves as approximately 14.67 square units. This represents the enclosed region between the curves y = x^2 and y = 2x - 6.

Learn more about Curves

brainly.com/question/20709936

#SPJ11:

So far in Unit 3, we have studied several hypothesis tests: 1-Prop z-Test, 2-Prop z-Test, 1-Sample t-Test, 2-Sample t-Test, and the Paired t-Test. For each scenario, identify the hypothesis test that should be applied. (1 point each) a. A researcher wants to test a claim that the average pounds of grapes on unfertilized vines decreases the yield of each grapevine when compared to the average pounds of grapes on fertilized vines. b. A researcher wants to test a claim that the average amount of time that kids spend reading books has decreased. c. A researcher wants to test a claim that students perform better on math problems when not listening to music as compared to when they do listen to music. d. A researcher wants to test a claim that the average age of professional baseball players is higher than the average age of professional football players. e. A researcher wants to test a claim that the proportion of children with autism has increased since 1990. f. A researcher wants to test a claim that there is a difference between the proportion of immigrants in the US and Canada.

Answers

a. The appropriate hypothesis test for this scenario would be a 2-Sample t-Test, as we are comparing the average pounds of grapes on unfertilized vines to the average pounds of grapes on fertilized vines.

b. The appropriate hypothesis test for this scenario would be a 1-Sample t-Test, as we are comparing the average amount of time kids spend reading books to a known or assumed value.

c. The appropriate hypothesis test for this scenario would be a Paired t-Test, as we are comparing the performance of the same students on math problems with and without music.

d. The appropriate hypothesis test for this scenario would be a 2-Sample t-Test, as we are comparing the average age of professional baseball players to the average age of professional football players.

e. The appropriate hypothesis test for this scenario would be a 1-Prop z-Test, as we are testing the proportion of children with autism.

f. The appropriate hypothesis test for this scenario would be a 2-Prop z-Test, as we are comparing the proportions of immigrants in the US and Canada.

Learn more about hypothesis test here:

https://brainly.com/question/30588452

#SPJ11

For a parade, a group of students marched in a square formation. If there were 1681 students in the parade, how many students were there in each row?

Answers

The number of students in each row was 41.

In this case, since the square formation has the same number of rows and columns, we can represent both dimensions as 'x'. Therefore, the total number of students in the parade can be expressed as:

Total number of students = Number of rows × Number of columns

Given that there were 1681 students in the parade, we can substitute the values into the equation:

1681 = x × x

Now we have a quadratic equation. To solve for 'x', we can take the square root of both sides since the square root of a number times itself equals the number:

√1681 = √(x × x)

41 = x

Therefore, there were 41 students in each row of the square formation.

To know more about square here

https://brainly.com/question/14198272

#SPJ4

Answer this - wrong answers will be reported/deleted

Answers

Answer:

58.03 ft

Step-by-step explanation:

To solve for the total circumference of circle F, we can create a ratio of section angle measure to circumference. We know that these two attributes of a circle have a linear relationship because the formula for arc length ([tex]S = 2\pi r \cdot \frac{\theta}{360\°}[/tex]) relies proportionately on the radius and angle measure of the section.

angle measure : circumference

               290°   :   46.75 ft

We can multiply this ratio by [tex]\frac{360}{290}[/tex] to get the corresponding circumference for a 360° section (which is the entire circle).

[tex]\frac{360}{290}(290\° : 46.75 \text{ ft})[/tex]

[tex]= 360\° : \boxed{58.03 \text{ ft}}[/tex]

Therefore, the circumference of circle F is approximately 58.03 ft.

if shadowland's workers can produce 6 lunch boxes or 18 sandwich containers per hour, then the opportunity cost of 1 lunch box is

Answers

The opportunity cost of 1 lunch box is 3 sandwich containers. This means workers are giving up the opportunity to produce 3 sandwich containers

The opportunity cost represents the value of the next best alternative forgone when making a choice. In this case, the workers at Shadowland have the option to produce either lunch boxes or sandwich containers.

Given that they can produce 6 lunch boxes or 18 sandwich containers per hour, we can calculate the opportunity cost.

To find the opportunity cost of 1 lunch box, we compare the number of sandwich containers that could have been produced in the same amount of time.

Since they can produce 18 sandwich containers per hour, the opportunity cost of 1 lunch box is the number of sandwich containers that could have been produced instead, which is 18/6 = 3.

Therefore, the opportunity cost of 1 lunch box is 3 sandwich containers. This means that for every lunch box produced, the workers are giving up the opportunity to produce 3 sandwich containers, which represents the trade-off in their production choices.

To know more about value click here

brainly.com/question/30760879

#SPJ11

An element with a mass of 310 grams disintegrates at 8.9% per minute. How much of the element remains after 19 minutes, to the nearest tenth of a gram?

Answers

The remaining mass of the element after 19 minutes is approximately 110.7 grams, rounded to the nearest tenth of a gram.

The mass of the element is decreasing at a rate of 8.9% per minute. Let's call the remaining mass of the element after 19 minutes "x". Then, the mass of the element after 1 minute would be 0.911 times x, since 8.9% of the mass disintegrates per minute.

After 2 minutes, the mass would be 0.911 times 0.911 times x, or 0.911² times x. In general, after t minutes, the mass would be:

x = 310 × [tex]0.911^t[/tex]

To find the remaining mass after 19 minutes, we plug in t = 19:

x = 310 × 0.911¹⁹ ≈ 110.7

To learn more about mass click on,

https://brainly.com/question/14487156

#SPJ1

9–16. divergence test use the divergence test to determine whether the following series diverge or state that the test is inconclusive. α 9. Σ k 2k +1 k=0 k 10. Σ x2 + 1 k=1 α 1 13 11. Σ 12. Σ 1000 +k k=0 3 + 1 k=1 8 13. k In k k=2 14. Σ k=1 24 α k Vk 15. Σ Ink 16. Σ k! k=2 k=1

Answers

Σ k/(2k+1) diverges. Σ (x^2+1)/k diverges.Σ (1000+k)/(3k+1) diverges.

Σ k ln(k) diverges. Σ k diverges. Σ ln(k) diverges. Σ k! diverges.

The divergence test states that if the limit of the nth term of a series is not zero as n approaches infinity, then the series must diverge. Using this test, we can determine whether the given series diverge or not.

For the first series, Σ k/(2k+1), as k approaches infinity, the limit of the nth term is 1/2, which is not zero. Therefore, the series diverges.

Similarly, for the second series, Σ (x^2+1)/k, the limit of the nth term is (x^2+1)/n, which does not approach zero as n approaches infinity. Therefore, the series diverges.

For the third series, Σ (1000+k)/(3k+1), as k approaches infinity, the limit of the nth term is 1/3, which is not zero. Therefore, the series diverges.

For the fourth series, Σ k ln(k), as k approaches infinity, the limit of the nth term is infinity, which is not zero. Therefore, the series diverges.

For the fifth series, Σ k, as k approaches infinity, the limit of the nth term is infinity, which is not zero. Therefore, the series diverges.

For the sixth series, Σ ln(k), as k approaches infinity, the limit of the nth term is infinity, which is not zero. Therefore, the series diverges.

For the seventh series, Σ k!, as k approaches infinity, the limit of the nth term is infinity, which is not zero. Therefore, the series diverges.

Learn more about diverges here:

https://brainly.com/question/31778047

#SPJ11

Other Questions
write a statement that opens a file customers.dat as a random access file for both reading and writing. the created object should be fstream. part 1: let x and y be two independent random variables with iden- tical geometric distributions. find the convolution of their marginal distributions. what are you really looking for here?1 Costco buys a Euro put option (contract size: 125,000) at a premium of $0.13/. The exercise price is $1.18/: If the spot at expiration is $1.08/, what is the Costco's profit? $3,750 loss O $16,250 loss O $12,500 loss $28,750 loss The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right.I. Which end of the DNA template is 5 and which end is 3?II. Give the sequence and identify the 5 and 3 ends of the RNA transcribed from this template. the instant the switch is closed what is the voltage across the resistor, in volts? rl switch circuit select one: a. 0 b. 20 c. 40 d. 2 A sandwich shop owner has the following information: P = MR = $4, ATC = $2, AVC = $1, MC = 4, and Q = 500. From this, she can determine: a. she has earned economic profits of $1,500. b. she has earned economic profits of $1,000. c. she has earned zero economic profits. d. her profits are not being maximized. a(n) ____ dialog box returns the result of a users action as a boolean value. Use the Inverse Matrix method to solve the following system of linear equations. 3X + Z = 31 2x - 2y + z = 7 Y + 3Z = -9 Can someone answer this question really quick Where do igneous rocks form?Select all that apply.ResponsesA. Igneous rocks form on Earths surface where magma reaches the surface.Igneous rocks form on Earths surface where magma reaches the surface. B. Igneous rocks form underneath Earths surface where magma cools down within the crust.Igneous rocks form underneath Earths surface where magma cools down within the crust. C. Igneous rocks form within Earths mantle where magma is typically found.Igneous rocks form within Earths mantle where magma is typically found. D. Igneous rocks form in Earths inner core where magma solidifies under heat and pressure. #17Part ARectangle PQRS is rotated 90 counterclockwise about the origin to create rectangle P'Q'R'S' (not shown). What are the coordinates of point R'?Responses(7,6)( - 7 , 6 )(7,6)( 7 , 6 )(6,7)( - 6 , 7 )(6,7)( 6 , 7 )Question 2Part BRectangle PQRS is reflected across the y-axis and then translated down 2 units to create rectangle P''Q''R''S'' (not shown). What are the coordinates of Q''?Responses(6,0)( - 6 , 0 )(6,0)( 6 , 0 )(6,4)( - 6 , - 4 )(6,2)( - 6 , 2 ) Several corporations are headquartered in Georgia, illustrating Georgia's role in world trade. Which Georgia-based corporation is LEAST LIKELY to have an international impact?. After cooking, foods should be held at ______ degrees F or higher until served.a. 120b. 130c. 140d. 150 In a tender offer, the aggressor offers target shareholders a price below the current market value of the ___ stock. listen with readspeaker the late 1960s and early 1970s saw the rise of networked systems. true or false Adrien arrives to lend his friend a fresh battery so the electronic device will turn on. This battery has enough energy to do 10,000 joules of work. Since work can be done by the battery, the expected sign for the voltage is ______ and this best represents ________. T/F : privacy laws were never intended to interfere with patient care Which of the following statements about genetically modified (GM) foods is FALSE: The FDA requires food manufacturers to state the genetically modified ingredient(s) content on food labels. A GM plant food could produce a protein that is allergenic to some people. According to the FDA, there is no information indicating that GM foods differ from other foods in any meaningful way. GM foods must meet the same safety, labeling, and other regulatory requirements required by the FDA for all foods. 100 Points! Geometry question. Photo attached. Please show as much work as possible. Thank you! (a) An 8-bit A/D converter has an input range of 0 to 15 V and an output in simple binary. Find the output (in decimal) if the input is (a) 6.42 V (6) -6.42 V (C) 12 V (d) OV (b) Convert Hexa decimal Number B602 to a decimal number and Binary. Convert decimal number 227 to binary number. Arrange the following in order of decreasing strength as reducing agents in acidic solution Zn, I, Sn2+, H2O2, Al.Rank from strongest to weakest. To rank items as equivalent, overlap them.I, Sn2+, Al, H2O2, Zn.