All levels of biological organization and discription?pllsss paki sagutan po​

Answers

Answer 1
The levels, from smallest to largest, are: molecule, cell, tissue, organ, organ system, organism, population, community, ecosystem, biosphere.

Related Questions

What is the difference between your biological sex and your gender identity?

Answers

Answer:

Biological or assigned sex is about biology, anatomy, and chromosomes and Gender is society's set of expectations, standards, and characteristics about how men and women are supposed to act.

Explanation:

Hope this helps!

biological sex is what gender you were born as and what's on your birth certificate. however, a persons gender identity is a persons own choice. it's what you classify yourself as and what you feel comfortable as, despite your biological sex. many people don't even identify as anything or they change their preference of pronouns. gender identity also comes with stereotypes given by the community and what they see fit for genders.

Mitosis is done by your body cells. What types of cells do not undergo mitosis

Answers

Answer:

Sex cells/ gametes

Explanation:

Sperm cells and egg cells don't go through mitosis

match the choices with each box.

Answers

Answer:

1 is totipotent

2 is mutipotent

3 is pluripotent

4 is totipotent

5 is pluripotent

6 is mutipotent

Explanation:

I honestly dont know sorry if they r wrong

the carbon cycle review of terms

Answers

Answer:

A solid line would represent point on the graph that actually are included in the solution, while points that lie on dash lines aren't included in the solution.

The carbon cycle takes place in the environment, where plants, herbivores, consumers, and decomposers are present and fix the carbon in the environment.

What is the carbon cycle?

The carbon cycle is important for the environment because carbon is present in the animal cell, in food, etc., and the carbon cycle is present in the given diagram. Here, the plant takes in the atmospheric carbon dioxide shown in the arrow 1, and the carbon dioxide is released by the animals and plants shown in the arrow 2.

Arrow 3 explains the rabbit taking the carbon from the food source, the plant releases oxygen and arrow 4 explains the carbon released by the decomposers from the animals and plants; and arrow 5 shows the carbon converted into fossil fuels. Arrows 6 and 7 both explain the release of carbon dioxide while plants use it for food synthesis.

Hence, the carbon cycle takes place in the atmosphere, where plants, herbivores, consumers, and decomposers are present and fix the carbon in the environment.

Learn more about the carbon cycle here.

https://brainly.com/question/1627609

#SPJ2

please help!! i’ll mark brainliest

Answers

Answer:

See if that helps, im pretty sure it increases :)

Explanation:

The rate of photosynthesis does not increase with higher temperatures for all plants. Plants which grow in colder climates have an optimum rate of photosynthesis at low temperatures. Therefore different types of plants have optimum temperatures for photosynthesis.

What is the correct term for organisms that consume other organisms in order to gain energy and are also known as consumers?
A) Heterotrophs
B) Decomposers
C) Detritivores
D) Autotrophs​

Answers

Answer:

Heterotrophs

Explanation:

A heterotroph is an organism that eats other plants or animals for energy and nutrients.

The correct term for organisms that consume other organisms in order to gain energy and are also known as consumers is Heterotrophs; option A.

What are heterotrophs?

Heterotrophs are organisms which cannot produce their own food but rather depend on other organisms for its food.

Heterotrophs consume other organisms such as plants and other animals for the production of energy.

Therefore, the correct term for organisms that consume other organisms in order to gain energy and are also known as consumers is Heterotrophs; option A.

Learn more about heterotrophs at: https://brainly.com/question/4933024

Which is an example of a ray-fin fish?
lungfish
O coelacanth
O shark
salmon

Answers

Explanation:

its showing all but salmon so im not sure,sorry, still trying

Answer: Salmon

Explanation:

bones

A student tries to push a refrigerator-sized box of textbooks safely across the classroom.

The box does not move. He asks for help from other students.

The box starts to move when the number of students shown in the image is pushing together.



Based on this information, what conclusion can be drawn?




The box has a mass greater than the combined mass of the first two students pushing.


The forces acting on the box became unbalanced when the third student started pushing.


The only force acting on the box is the push applied by the students.


When the third student started to push, the box’s mass decreased

Answers

Answer:

The forces acting on the box became unbalanced when the third student started pushing.

Explanation:

The horizontal forces, friction and applied, were balanced until more force was applied than friction. Mass can't increase or decrease.

Answer:

The forces acting on the box became unbalanced when the third student started pushing.

Explanation:

Phineas and Ferb build a flying machine. They accelerate into the air in a
straight line, going from 0 m/s to 30 m/s in 3 s. Find their average
acceleration.

Answers

10

30 dived by 3 = 10

hope it helps

If you wanted to find an ant's stomach, where would
you look?
a. Inside its head
b. Inside its cephalothorax
c. Inside its thorax
d. Inside its abdomen

Answers

Answer:

d. Inside its abdomen

Explanation:

Hope this helps!

D, inside its abdomen

Which gland is known as the "master gland" because it sends chemical messages to many other glands?

Answers

Answer: pituitary gland

describe how acid precipitation affects ecosystems
will give brain crown thingy

Answers

Answer: Acid rain makes such waters more acidic, which results in more aluminum absorption from soil, which is carried into lakes and streams. Trees' leaves and needles are also harmed by acids... They are most clearly seen in aquatic environments, such as streams, lakes, and marshes where it can be harmful to fish and other wildlife.

Explanation: YW <3

Put "Allele Frequency" in a sentence

Answers

Answer:

With this data we can built a map of allele frequency and geographic location.

Answer: Here are a variety of sentences you could use...

1. Jensen was born with blue eyes because each of his parents gave him a recessive allele for the trait.

2. The dominant allele is the one that determines a physical characteristic or trait.  

3. Because Jill’s parents both gave her the dominant allele for curly hair, she has a wavy hair texture.

4. Which allele is responsible for blonde hair, the recessive allele or the dominant allele?  

5. On the other hand, the recessive allele is always overshadowed by its dominant partner.  

Without genetic variation, natural selection would not be possible. Explain why.

Answers

Answer:

Without genetic variation, natural selection is only able to grow the number of allelomorphs that previously exited in the population. Natural selection occurs through an interaction between the environment and the variability of the individual organisms making up a population. If every giraffe had the same neck length, there would be nothing to change and they would never have a long neck by now.

Which of the following has to
occur in order for mammals to
create offspring?
A. fertilization
B. self-reproduction
C. mutation
D. self-fertilization

Answers

A. Fertilization, would be your answer

WILL GIVE BRAINLIEST!!

A magnetic globe is being held down on a base. When released, the globe rises above the base and eventually comes to rest floating above the base.

In which position shown does the globe have the greatest magnetic potential energy?

Answers

Answer:

Position 1 as the magnetic potential energy is waiting to be released when the hand moves.

Explanation:

When you by strawberry is "TEXTURE " matters? and why is that?

Answers

Answer:

Yes, it does.

Explanation:

If the strawberry you buy is all soggy and way too soft, it is likely rotten, while the normal texture we are used to shows that it is edible.

Answer:

Frozen strawberries were characterized organoleptically by a moist, soft and limp appearance, and poor shape retention. They felt very soft, moist, limp and slightly slimy in the mouth. Interior fibers had a tough texture.

put "Speciation" in a sentence

Answers

Answer:

It flies in the face of currently accepted views of speciation.

Answer:

chromium speciation by different methods of practical use for routine in situ measurement.

Explanation:

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

What change caused the rate of population growth to increase around point C?

Answers

Answer:

point c

Explanation:

HELP ASAP WILL GIVE BRAINLISET Which of the following describes the Cell Theory?

Group of answer choices

(A)All

(B)All living things are composed of one or more cells.

©Cells are the basic unit of life

(D)Cells are produced from existing cells

Answers

Answer:

C. Cells are the basic units of life.

Explanation:

Answer: A.) All
Explanation: Wikipedia :/

Yall Im struggling, if u cant read it, the question is “why does a mountain climber need an oxygen supply at very high altitudes, even tho the air still contains 21% oxygen?

Answers

Answer: Because it is harder to draw breath in. And the cold

Explanation: At higher altitudes, it becomes more dangerous, and you can develop altitude-related illnesses such as HAPE and HACE. I read a book called Into Thin Air, and in the book the author goes into detail on the details/complications of climbing Mt.Everest and oxygen needs. Mountain climbers use canisters of oxygen called Supplemental Oxygen.

Put "Evolution of Populations" in a sentence

Answers

Answer:

animals are examples of evolution of population

Explanation:

Which of the following most accurately describes the National Postsecondary Agricultural Student Organization?
(a)A rival group to FFA.
(b)2.A group similar to FFA but for graduate students.
(c)A group similar to FFA but for college students.
(d)The British version of FFA.

Answers

Answer:

Explanation:

a

Answer:

It's a

Explanation:

Which of the following statements is FALSE?
A. RNA is a single stranded molecule
B. RNA contains uracil
C. RNA is found only in the cytoplasm.
D. RNA contains ribose

Answers

Answer:

C

Explanation:

RNA is found mostly in the nucleus but can also be found in the cytoplasm, but it is not limited to it.

Material rising from the mantle reaches the surface at spreading centers.
A. True
B. False

Answers

Yes, It's true!

Explanation:

Material rising from the mantle reaches the surface at spreading centers.

A. True

B. False

A student knows the width and
length of a dresser. What else
should she measure so she can
calculate the volume?
A. Mass
B. Density
C. Height

Answers

Answer:

C. Height

Explanation:

The volume of a rectangle is Length x width x height.

The student has only measured the width and length so far, the only thing left to measure is the height.

The other answers don't make sense.

Hope this helps!!

- Kay :)

Answer:

c

Explanation:

The EPA sets national air-quality standards for common air pollutants. The
data table shows the change in concentrations of these pollutants over time.
Emissions Reductions and Air Quality
Data period
Reduction
Pollutant
Improvement
(from/to)
in emissions (%) in air quality (%)
СО
69
85
Pb
99
98
1980 - 2014 NO,
55
60
0,
53
33
81
80
16
30
2000 - 2014
33
36
SO2
PM,
PM25
Which conclusion do the data support?

Answers

The data support the conclusion that reducing emissions leads to improvement in air quality for the common air pollutants monitored by the EPA.

What is EPA?

The Environmental Protection Agency (EPA) is a federal agency of the United States government that was established in 1970 to protect human health and the environment. The EPA's mission is to ensure that all Americans have clean air to breathe, clean water to drink, and safe land to live and work on. The agency is responsible for setting and enforcing national standards for air and water quality, as well as for managing toxic waste and other pollutants.

The EPA also works with other federal agencies, states, tribes, and local governments to address environmental challenges, such as climate change, ozone depletion, and exposure to hazardous substances. The EPA uses a range of tools and programs, including research and development, regulation, partnerships, and education and outreach, to achieve its mission. The agency also provides information and technical assistance to help individuals, communities, and businesses protect the environment and public health.

Learn more about EPA, here:

https://brainly.com/question/30240841

#SPJ1

Answer:

B . With monitoring, the concentration of every pollutant has decreased

Explanation:

Which of these contributes the most oxygen to our planet?

a. Photosynthetic fungi
b. The Amazon Rain forest
c. the National Forests
d. Phytoplankton

Answers

Answer:

D. Phytoplankton

Explanation:

The majority of this production is from oceanic plankton — drifting plants, algae, and some bacteria that can photosynthesize.

Have a wonderful day! <3

Answer:

D

Explanation:

this is because the ocean produces the most oxygen and most of that comes from plankton in the ocean

A rusty nail is an example of an oxidation-reduction reaction.
A. True
B. False

Answers

Answer:true

Explanation:

Other Questions
need explaing and working out ignore squiggly line! A small business that competes in a market where demand is price elastic is introducing a system of quality assurance. Analyse how quality assurance might improve its competitiveness. (9 marks) Pls h.e.l.p. Meeeeee Which of these changes is an example of a chemical change? A.) evaporation of water from a pan. B.) water droplets forming outside a glass on a hot day. C.) cooking an egg. D.) dry ice turning into a gas. A 2 kg box slides down a frictionless ramp startingfrom a height of 3 m. The slope of the ramp is 30,What is the box's momentum when it reaches thebottom of the ramp?Answers: A) 15.3 kgm/s down the rampB) 7.7 kg.m/s down the rampC) 5.5 kgm/s down the rampD) 2.8 kgm/s down the ramp Question 2-1A company is offering a bank account. The value, in dollars, of the account is represented by the function A(r) = 50,000(1.02), where t represents the number of years sincethe account was first opened. Determine the average rate of change of the account value from t=0 to t=5. Express your answer to the nearest cent. What is legal frame work? find the equation of the lines on the graph Use Desmond to graph the following system of inequalities.y 1/4x +3y -x+2Then choose the following points that are solutions to the system.A.(0,0)B.(2,1)C.(3,3)D.(-1,1)E.(0,1) Solve tan (0) = 1 on the interval [0, ).The answers are A and B where 0 < A A =B= 1. The land farthest north was claimed bya.Englandb. Francec. Spaind.Portugal2.Most of the east coast of North America was claimed bya. England and Franceb. O France and Portugalc. Spaind. O Portugal3.The largest island shown east of North America and west of Europe isa. O Greenlandb. O Icelandc. O England A data analyst wants to quickly create visualizations and then share them with a teammate. They can use _____ for the analysis. Are the buying and selling of stocks centralized activity Why or why not? The existence of a dose-response relationship may be used to establish which of the following kinds of information This matrix represents the length and width of a rectangle: matrix one applying a scale factor means multiplying the length and width by the same factor to produce a similar rectangle. Use matrix multiplication to double the length and width of rectangle: matrix two a = b =. How does the Boyce and Perrins model differ from the Lack modol for oxplaining optimal clutch sizo? The Boyce and Perrins model accounts for year-to-year predictability in food supply and variation survival rates The Boyce and Perrins model assumes that there are specific parental traits that affect offspring survival probabilities. The Boyce and Perrins model suggests that average clutch size should be Ihe maximum possible clutch size in good year The Boyce and Perrins model accounts for the increasing day lengih as (he spring progresses toward summer each year I NEED HELP QUICKLY!!!!Identify which Spanish words are llana, aguda, or esdrjula.lbum silla ballets lgrimas csped rbol palabra razn dolos cmprame estoy rpido pasin balonTHANK YOU TO THE ANGEL THAT HELPS ME!! How much food can be grown on a mechanized farm?O enough for the familyO enough for 10 peopleenough for 100 peopleO enough for 1,000 people Getting a new phone is a really cool feeling, but your phone can't do much without applications. In order to get the most from your new phone, you need to download apps. To do this you will need a data connection. Some plans allow you to get data from your phone network. If your plan lets you to do this, you can connect to web services anywhere that your phone gets a signal. If your plan does not let you to do this, you will need to connect your device to a Wi-Fi network. Free Wi-Fi can be found at coffee shops, laundry mats, and other public locations. Once your phone is receiving data, go to the application store on the device. Use the search or browse functions to find fun, interesting, or useful programs. Once you have found an application that you want to try, click the button to download and install it on your device. Not all applications are free, so make sure that you know how much the app costs before agreeing to download it. Also, if you are under the age of 18, get your parent's permission before downloading anything. You'll like your new phone so much more once you have some cool apps.6. Which text structure is used in Paragraph #6? **(Choose ONE)*O a. cause and effectO b. chronological c. compare and contrast d. descriptionO e. problem and solutionO f. sequential PLS HELLPPPP I NEED HELP What is a Major risk associated with licensing?