Compare and contrast Daniel Webster and John Calhoun’s responses to the Compromise of 1850.

Answers

Answer 1

Although Daniel Webster supported the elements of the Compromise Henry Clay presented, he was opposed to the expansion of slavery, like many other northerners.

What is the Compromise of 1850?

The agreement permitted the newly acquired territories to chose whether or not to practice slavery, while still allowing California to join the union as a "free" (non-slavery) state. The Fugitive Slave Act, which turned out to be quite unpopular in the North, was part of the Compromise.

However, John Calhoun believed that because the proposal did not provide the South with any security, any agitation over the subject of slavery would result in the South seceding from the Union.

To learn more about Compromise of 1850

https://brainly.com/question/29761975

#SPJ1


Related Questions

9) which Roman emperor was criticized for his torrid love affair


with an Eastern princess?

Answers

Answer: Titus Caesar Vespasianus was Roman emperor from 79 to 81. A member of the Flavian dynasty

examining what events caused president roosevelt to become more of an internationalist?

Answers

The events which caused President Roosevelt to become more of an internationalist included rise of authoritarian regimes, outbreak of World War II, and Pearl Harbor attack by Japanese.

President Roosevelt's decision to become more of an internationalist can be attributed to several key events that occurred during his presidency.  Firstly, the rise of authoritarian regimes in Europe, such as Nazi Germany and fascist Italy, posed a significant threat to global stability and security. Roosevelt recognized the dangers of these regimes early on and believed that the United States had a responsibility to intervene in order to prevent further aggression and protect democratic values.

Secondly, the outbreak of World War II in 1939 demonstrated the devastating consequences of isolationism and non-intervention. Roosevelt saw the war as an opportunity for the United States to play a more active role on the world stage and work towards a more peaceful and stable international order.

Thirdly, the Japanese attack on Pearl Harbor in December 1941 solidified Roosevelt's commitment to internationalism. The attack demonstrated the interconnectedness of global events and the need for the United States to engage in international affairs to protect its own security and interests.

Overall, Roosevelt's evolution towards internationalism can be seen as a response to the changing global landscape and the recognition that the United States could not afford to remain isolated and detached from international affairs.

Learn more about President Roosevelt:

https://brainly.com/question/25608255

#SPJ11

Week 34 Mesoamerican civilizations crossword

Answers

Mesoamerican civilizations included the Olmec, Maya, Zapotec, Teotihuacan, Mixtec, and Aztec, developing complex societies and advanced achievements.

Mesoamerican civilizations, such as the Olmec, Maya, Zapotec, Teotihuacan, Mixtec, and Aztec, emerged between 2000 BCE and 1519 CE. They developed complex societies with advanced achievements in agriculture, architecture, art, writing systems, and mathematics.

Prominent cities like Teotihuacan, Palenque, and Tenochtitlan featured large temples, plazas, and pyramids. The Maya were known for their hieroglyphic script and calendar systems, while the Aztecs established a vast empire in Central Mexico.

These civilizations contributed significantly to the cultural and historical development of Mesoamerica, with some aspects still influencing the region today.

For more such questions on Mesoamerican, click on:

https://brainly.com/question/14171665

#SPJ11

Major crises in Eastern Europe and the Middle East create severe challenges for Eisenhower's foreign policy. An American plane over the Soviet Union, disrupting a summit and retiling the Cold War. Eisenhower refuses to use American troops to prevent a communist victory over a colonial power in Asia. t/f

Answers

True.

Major crises in Eastern Europe and the Middle East did pose significant challenges for Eisenhower's foreign policy. One such crisis involved an American plane, the U-2 spy plane, being shot down over the Soviet Union in 1960.

This incident disrupted a scheduled summit between the United States and the Soviet Union and intensified the already tense relations of the Cold War. The U-2 incident heightened mistrust between the two superpowers and had negative implications for Eisenhower's efforts to improve relations with the Soviet Union.

Another challenge for Eisenhower's foreign policy was the refusal to use American troops to prevent a communist victory over a colonial power in Asia. This likely refers to the Vietnam War, where Eisenhower, and later his successor President Kennedy, were hesitant to commit large-scale American military forces to prevent the communist takeover of South Vietnam. This decision reflected the complexities and limitations of American foreign policy in the face of the growing Cold War and the desire to avoid direct confrontation with the Soviet Union and China.

to learn more about Eastern Europe click here; brainly.com/question/1087487

#SPJ11

between the early 1800s and today, the percentage of the population living in urban areas in the united states has changed by a factor of ___________.

Answers

The percentage of the population living in urban areas in the United States has increased by a factor of approximately 6 since the early 1800s.

In the early 1800s, the United States was primarily rural, with a small percentage of the population residing in urban areas. As industrialization and urbanization progressed, the urban population grew significantly. This transformation was fueled by factors such as technological advancements, economic opportunities, and changes in agricultural practices. By the present day, around 80% of the U.S. population lives in urban areas, marking a substantial increase compared to the earlier period.

Over time, the United States experienced a substantial shift in population distribution, with more people gravitating towards urban centers. This phenomenon can be attributed to various factors. The Industrial Revolution brought about significant changes, including the rise of factories and manufacturing industries, which attracted workers to cities. Additionally, advancements in transportation, such as railroads and automobiles, made it easier for people to access urban areas for employment and improved quality of life.

To learn more about urbanization click here

brainly.com/question/29987047

#SPJ11

Select all of the following statements that were true of the irrationalist critique of modernity:
1. It often associated Jews and rationality.
2.It protested against what it saw as the dehumanizing effects of industrialization.
3.It protested against the commercialization of culture.
4. It often presented nationality as something spiritual and racial.

Answers

The true statements of the irrationalist critique of modernity are:

It protested against what it saw as the dehumanizing effects of industrialization.

It protested against the commercialization of culture.

It often presented nationality as something spiritual and racial.

The irrationalist critique of modernity emerged in response to the rapid industrialization and societal changes of the late 19th and early 20th centuries. It rejected the Enlightenment ideals of reason, progress, and individualism, instead emphasizing the importance of emotions, spirituality, and communal identity. It criticized the dehumanizing effects of industrialization, highlighting the loss of human connection and the degradation of human values in the pursuit of material wealth. It also condemned the commercialization of culture, viewing it as a threat to authentic artistic expression and a degradation of traditional values.

Additionally, the irrationalist critique often linked nationality to spiritual and racial characteristics, asserting the importance of preserving cultural and ethnic identities in the face of homogenizing forces of modernity.

To learn more about  dehumanizing effects click here; brainly.com/question/31590269

#SPJ11

by the 1970s, some architectural historians began to argue that modernist steel-cage rectangular solids were threatening to __________.

Answers

Answer: to bury the nation's cities in boredom

Answer: To bury the nations sites in boredom

Explanation: sorry for saying the same thing as the other person but when you search for the answer of your question it says the same thibg

since world war ii, many latin american dramatists began to focus on

Answers

Since World War II, many Latin American dramatists have shifted their focus to explore social and political issues prevalent in their countries.

In the aftermath of World War II, Latin American dramatists experienced a significant transformation in their artistic approach. Rather than solely emphasizing traditional themes and forms, they turned their attention toward the pressing social and political issues affecting their respective nations. This shift was a response to the turbulent times marked by the rise of dictatorships, economic inequalities, and a quest for self-determination.

The works of these dramatists delve into the complexities of post-colonial societies, exploring the multifaceted nature of power dynamics, systemic oppression, and the struggles faced by marginalized groups. Through their plays, these artists expose the injustices and human rights abuses perpetrated by authoritarian regimes, shedding light on the social, economic, and cultural challenges faced by their communities.

To learn more about political issues  click here:

brainly.com/question/900205

#SPJ11

describe life in the soviet union after 1964. what were the positive and negative features of the soviet state in the brezhnev era?

Answers

Life in the Soviet Union after 1964, during the Brezhnev era, had both positive features like economic stability and social welfare programs and negative features like Stagnation and Bureaucracy.

Describe life in the soviet union after 1964?

Positive Features:

1. Economic Stability: The Soviet Union experienced a period of economic stability during the Brezhnev era, with steady industrial growth and improved living standards for many citizens. The government focused on achieving economic growth and maintaining a relatively high standard of living compared to previous periods.

2. Social Welfare Programs: The Soviet state implemented various social welfare programs, providing free healthcare, education, and housing to its citizens. Access to these services was relatively widespread, ensuring a certain level of social security.

Negative Features:

1. Stagnation and Bureaucracy: The Brezhnev era was characterized by a period of political and economic stagnation. Bureaucratic inefficiencies and a lack of innovation hindered progress and led to a decline in overall productivity. The Soviet system became increasingly rigid and resistant to change.

2. Limited Political Freedom: The Soviet Union maintained strict control over political dissent and limited individual freedoms. Freedom of speech and political expression were heavily curtailed, with dissent often met with repression. This lack of political pluralism stifled public discourse and democratic participation.

3. Corruption and Privilege: The Brezhnev era saw the rise of corruption and a growing divide between the political elite and ordinary citizens. Nepotism and favoritism within the ruling class led to a sense of disillusionment and inequality among the population.

4. Economic Inefficiencies: Despite the economic stability, the Soviet economy faced challenges related to inefficiencies, central planning, and a lack of market mechanisms. The state-controlled economy struggled to innovate and keep pace with global developments, resulting in a shortage of consumer goods and limited economic diversification.

The positive features of the Soviet state in the Brezhnev era included economic stability and social welfare programs, while the negative features encompassed stagnation, limited political freedom, corruption, and economic inefficiencies.

To learn more about soviet union, visit

#SPJ11

• according to the textbook, what is the most important provision of the u.s. constitution with respect to civil rights?

Answers

The most important provision of the U.S. Constitution regarding civil rights, as stated in the textbook, is the Fourteenth Amendment.

The Fourteenth Amendment is considered the most significant provision of the U.S. Constitution in terms of civil rights. Ratified in 1868, it includes various clauses that protect individual rights and ensure equal protection under the law.

The first section of the amendment, known as the Equal Protection Clause, prohibits states from denying any person within their jurisdiction equal protection of the laws. This clause has been crucial in advancing civil rights, as it has been used to challenge discriminatory practices and promote equality in areas such as race, gender, and other protected classes.

The Fourteenth Amendment has played a pivotal role in shaping civil rights jurisprudence in the United States.

To learn more about civil rights click here:  brainly.com/question/14397578

#SPJ11

TRUE/FALSE. The once prosperous Confederate General Braxton Bragg returned from the Civil War to find he had lost everything and lived for some time with his wife in a slave cabin.

Answers

The statement 'The once prosperous Confederate General Braxton Bragg returned from the Civil War to find he had lost everything and lived for some time with his wife in a slave cabin' is false as there are no such evidence.

There is no evidence that Confederate General Braxton Bragg returned from the Civil War to find he had lost everything and lived in a slave cabin with his wife. While Bragg did face financial difficulties after the war, he never lived in a slave cabin with his wife. This claim is a myth that has been debunked by historians.

Hence, Confederate General Braxton Bragg did not live in a slave cabin after the Civil War. After the war, he worked as a civil engineer and later served as the Chief of Police in Mobile, Alabama. Although the war had a significant impact on his personal and professional life, he did not lose everything and was not forced to live in a slave cabin with his wife. Hence, the statement is false.

Learn more about Confederate General:

https://brainly.com/question/3014620

#SPJ11

washington dc was built on land ____ by virginia and maryland

Answers

Washington D.C. was built on land ceded by the states of Virginia and Maryland. The land was originally part of the District of Columbia, which was established by the United States Congress in 1790 as the permanent capital of the United States. The District was created from land donated by both Virginia and Maryland, which was then consolidated into a single federal district.

Consider the topic of the "American Politics in Comparative Perspective" feature. In


parliamentary systems, both the prime minister and the Cabinet are ultimately


accountable to parliament. In the U. S. , the executive and legislative branches are


separate and co-equal. What are the major advantages and disadvantages of each


system?

Answers

In parliamentary systems, both the prime minister and the Cabinet are ultimately accountable to parliament, while in the U.S., the executive and legislative branches are separate and co-equal. Each system has major advantages and disadvantages.

In parliamentary systems, the major advantage is the close relationship between the executive and legislative branches, allowing for more efficient decision-making and swift policy implementation. The prime minister can enjoy a stable majority in parliament, ensuring a smoother governance process. However, a disadvantage is the potential for concentration of power in the hands of the prime minister, reducing checks and balances and potentially undermining democratic principles. In the U.S., the major advantage of separate executive and legislative branches is the system of checks and balances, preventing any one branch from becoming too powerful. This fosters a higher degree of accountability and safeguards against authoritarianism. However, a disadvantage is the potential for gridlock and partisan conflicts that can impede policy-making and slow down governance.

Learn more about  parliamentary systems here:

https://brainly.com/question/11903927

#SPJ11

Which statement describes super PACs?

They do not get involved in elections.
They support all candidates equally.
They operate the same as regular PACs but with more money.
They can raise an unlimited amount of money.

Answers

Super PACs are political action committees that can raise an unlimited amount of money from corporations, unions, and individuals.

They are not affiliated with any specific candidate or political party, but rather operate independently to support or oppose candidates through the production and dissemination of political ads and other forms of communication. Unlike regular PACs, which are subject to limits on contributions and spending, super PACs can spend as much as they want to influence elections.

The main purpose of super PACs is to provide a means for wealthy individuals and interest groups to use their financial resources to influence elections in favor of their preferred candidates or issues. While they are technically required to disclose their donors and expenditures to the Federal Election Commission, super PACs can also engage in activities that are not directly related to electoral politics, such as issue advocacy and voter mobilization.

For more questions on PACs

https://brainly.com/question/2163285

#SPJ11

Governor James Hogg's ideas would be most closely associated with __________ and __________

Answers

Governor James Hogg's ideas would be most closely associated with populism and progressive reforms.

Governor James Hogg was a prominent figure in Texas politics during the late 19th and early 20th centuries. He championed the cause of populism by advocating for the rights and well-being of ordinary citizens. Hogg believed in reducing the influence of big corporations and wealthy individuals in politics and ensuring that the government served the interests of the common people. His policies aimed to improve the conditions of farmers, workers, and other marginalized groups, often by implementing regulations and reforms that protected their rights and economic well-being.

Furthermore, Governor Hogg was known for his progressive stance on various issues. He supported social reforms such as women's suffrage and workers' rights, recognizing the importance of equal opportunities and fair treatment for all citizens. Hogg also promoted educational reforms, emphasizing the importance of accessible and quality education for all children. His efforts led to significant advancements in public education in Texas, including increased funding and improved standards.

To learn more about progressive reforms click here:

brainly.com/question/28886036

#SPJ11

Match the term to the appropriate blanks to complete the sentence. Question 7 options: biodiversity species diversity genetic diversity extinction extirpation species 1. A _____ is a distinct type of organism, a set of individuals that uniquely share certain characteristics and can breed with one another and produce fertile offspring.

Answers

A species represents a distinct group of organisms with shared characteristics and reproductive compatibility. Understanding species and their diversity is essential for comprehending the intricate connections within ecosystems and the preservation of biodiversity.

A species is a fundamental concept in biology that refers to a distinct type of organism. It represents a group of individuals that share common characteristics and have the ability to interbreed and produce fertile offspring. The concept of a species is central to our understanding of diversity and the classification of living organisms.

Each species occupies a unique ecological niche and plays a specific role within its ecosystem. The diversity of species is a vital component of ecosystem health and stability. Species diversity refers to the variety of different species present in a particular habitat or ecosystem.

The existence of different species also contributes to genetic diversity. Genetic diversity refers to the variation in genetic information within a species, including the different alleles and gene combinations present. Genetic diversity is crucial for the adaptability and resilience of species to environmental changes.

The loss of species, known as extinction, can have severe ecological consequences. Extinction occurs when a species no longer has any living members. Extirpation, on the other hand, refers to the localized extinction of a species in a specific geographic area while still existing elsewhere.

In summary

Learn more about diversity here:

https://brainly.com/question/9279105

#SPJ11

how did presidents hoover and roosevelt differ in their attempts to respond to the great depression?

Answers

Hoover favored limited government intervention, while Roosevelt implemented a proactive and interventionist approach through the New Deal, signaling their contrasting strategies during the Great Depression.

Presidents Hoover and Roosevelt approached the Great Depression with contrasting strategies, reflecting their differing ideologies and perspectives on the role of government in the economy. Herbert Hoover, serving as president from 1929 to 1933, initially relied on a more hands-off approach.

He believed in limited government intervention and advocated for voluntary cooperation between businesses and individuals. Hoover believed that the economy would eventually self-correct and recover. In contrast, Franklin D. Roosevelt, who took office in 1933, implemented a more proactive and interventionist approach. He introduced the New Deal, a comprehensive set of programs and reforms aimed at providing relief, recovery, and reform.

Roosevelt's administration focused on stimulating economic growth through massive public works projects, such as the Works Progress Administration and the Civilian Conservation Corps. He also implemented regulations to stabilize the financial system, such as the creation of the Securities and Exchange Commission and the Glass-Steagall Act.

To learn more about Roosevelt

https://brainly.com/question/29797674

#SPJ4

What egyptian pharaoh is represented by the colossi of memnon?.

Answers

The Egyptian pharaoh represented by the Colossi of Memnon is Amenhotep III.

The Colossi of Memnon are two massive stone statues located on the west bank of the Nile River in Luxor, Egypt. These statues depict Pharaoh Amenhotep III, who reigned during the 18th Dynasty of ancient Egypt. The statues originally stood at the entrance of Amenhotep III's mortuary temple, which was destroyed over time. Each statue is about 18 meters tall and carved from a single piece of stone. The Colossi of Memnon are famous for the mysterious "singing" or "whistling" sounds they produced at dawn due to temperature changes. Although damaged by earthquakes and time, they remain significant symbols of ancient Egyptian art and civilization.

You can learn more about Amenhotep III at

https://brainly.com/question/17488277

#SPJ11

T/F The dominant theme of 2 Timothy is Timothy’s departure from the truth which Paul was seeking to correct.

Answers

The given statement "The dominant theme of 2 Timothy is Timothy’s departure from the truth which Paul was seeking to correct" is False because the dominant theme of 2 Timothy is not Timothy's departure from the truth but rather Paul's encouragement for Timothy to stay faithful, strong, and committed to the gospel in the face of challenges.

The dominant theme of 2 Timothy is not Timothy's departure from the truth but rather Paul's encouragement for Timothy to remain faithful and strong in the face of adversity. Paul, the apostle, wrote this letter to Timothy, a young leader in the early Christian church, to provide guidance and support.

In 2 Timothy, Paul urges Timothy to hold onto the teachings he has received and to continue preaching the gospel despite the challenges he may face. This includes resisting false teachings, enduring suffering for the sake of Christ, and maintaining a godly character. The letter also emphasizes the importance of sound doctrine and highlights the power of Scripture for teaching, rebuking, and training in righteousness.

One key message in 2 Timothy is the concept of passing on the faith from one generation to the next, as Paul had done with Timothy. Paul encourages Timothy to train other faithful followers who can continue to spread the gospel after Paul's departure. This highlights the importance of mentorship and discipleship in the Christian faith.

In conclusion, the dominant theme of 2 Timothy is not Timothy's departure from the truth but rather Paul's encouragement for Timothy to stay faithful, strong, and committed to the gospel in the face of challenges. The letter serves as a reminder of the importance of sound doctrine, godly living, and mentorship in the Christian faith.

Know more about Christian faith here:

https://brainly.com/question/5136192

#SPJ11

Texas history word that isn’t too broad that starts with y for 7th grade

Answers

A Texas history term that starts with the letter "Y" and is not too broad for 7th grade could be "Ysleta del Sur Pueblo." Ysleta del Sur Pueblo is a Native American community located in the El Paso area of Texas. The Ysleta del Sur Pueblo has a rich history and cultural significance in Texas, I think it’s a suitable term for 7th-grade Texas history studies.

How did Lincoln's and Douglas's views about slavery and the future of the United States differ?


A. Douglas thought the outcome of the Dred Scott decision would

preserve the union, while Lincoln thought that the union could only

be preserved if the decision was overturned.


B. Douglas felt that slavery would start to divide the United States,while Lincoln felt that popular sovereignty would preserve the union.


C. Lincoln felt that slavery would continue to divide the United

States, while Douglas felt compromises would preserve the union.


D. Lincoln supported popular sovereignty to preserve the union, while Douglas thought compromises between northern and southern states would work

Answers

The correct answer is C. Lincoln believed that slavery would continue to divide the United States and that compromise would not solve the issue, while Douglas believed that compromises could preserve the union.

How did their views differ?

In the context of the Lincoln-Douglas debates, Douglas espoused the notion of popular sovereignty, whereby the inhabitants of each territorial or state jurisdiction would exercise their discretion with respect to the permissibility of slavery.

Opposedly, Lincoln espoused the view that the institution of slavery was ethically unjustifiable and prophesized its potential to foment discord and disunity throughout the nation.

The author posited that the nation should strive toward the complete abolition of slavery instead of settling for a compromised coexistence with the institution. The divergent views regarding the ramifications of the Dred Scott ruling did not constitute a primary point of contention between the parties under consideration.

Read more about slavery here:

https://brainly.com/question/9374853
#SPJ4

which member of andrew jackson's kitchen cabinet wrote the president's speeches?

Answers

Answer: Amos Kendall

1. find the product of each pair of numbers. then, plot some points to the show the relationship between the first number and the product.


2. is the relationship between the first number and product exponential? explain how you know

Answers

1. To find the product of each pair of numbers, I would need specific numbers to work with. Please provide the pairs of numbers you would like me to calculate and plot the points for, and I'll be happy to assist you further.

2. Determining whether the relationship between the first number and the product is exponential requires analyzing the pattern observed in the plotted points. Since you haven't provided any specific pairs of numbers or plotted points, I'm unable to evaluate the relationship. However, in an exponential relationship, the output (product) increases exponentially as the input (first number) increases. This means that as the first number increases by a constant factor, the product also increases by a constant factor. If you provide the plotted points or describe the pattern observed, I can help you determine whether the relationship is exponential based on the given information.

Learn more about evaluate here:

https://brainly.com/question/20067491

#SPJ11

What might have helped the Greek city-states to be more cooperative at the end of the Peloponnesian War?​

Answers

One thing that might have helped the Greek city-states to be more cooperative at the end of the Peloponnesian War could have been a mediator to help negotiate a peace agreement.

What is "For to everyone who has, more will be given, and he will have abundance; but from him who does not have, even what he has will be taken away. " often paraphrased as?

Answers

The quote "For to everyone who has, more will be given, and he will have abundance; but from him who does not have, even what he has will be taken away" is often paraphrased as "The rich get richer, and the poor get poorer."

This paraphrase captures the essence of the quote, which reflects the concept of wealth accumulation and inequality. It suggests that those who already possess wealth or resources will continue to gain more, leading to abundance, while those who are lacking will experience further deprivation. This phrase is often used to describe a socio-economic phenomenon where disparities in wealth and opportunity perpetuate over time, with the affluent benefiting from advantages and the disadvantaged facing increased challenges. It highlights the unequal distribution of resources and the potential for a cycle of poverty and wealth concentration.

Learn more about quote

https://brainly.com/question/29890162

#SPJ11

The Chronicle of St. Denis claims that the Franks killed 300,000 Muslim soldiers at the Battle of Tours (Poitiers) but also lost 300,000 their own men.

Group of answer choices
A. True
B. False

Answers

The given statement "The Chronicle of St. Denis claims that the Franks killed 300,000 Muslim soldiers at the Battle of Tours (Poitiers) but also lost 300,000 their own men" is false because the Chronicle of St. Denis does mention the Battle of Tours (Poitiers), which took place in 732 AD between the Franks led by Charles Martel and the Muslim forces led by Abd al-Rahman al-Ghafiqi.

However, the claim that 300,000 Muslim soldiers and 300,000 Frankish soldiers were killed in the battle is not accurate. Modern historical estimates place the number of casualties for both sides at a significantly lower figure. The exact number of casualties is difficult to determine due to a lack of reliable primary sources, but it is generally believed that around 10,000 to 12,000 Muslim soldiers and 1,000 to 2,000 Frankish soldiers were killed in the battle.

The Battle of Tours is considered a pivotal event in European history, as it halted the Muslim expansion into Western Europe and helped solidify the foundations of the Carolingian Empire. However, the figures provided by the Chronicle of St. Denis for the number of casualties on both sides are not consistent with the current historical understanding of the battle.

For more about Battle of Tours:

https://brainly.com/question/510631


#SPJ4

Select the correct text in the passage. Read this excerpt from the Declaration of Independence. Which portion of the text reflects the Founding Fathers' ideas about the natural rights all people are entitled to?

Answers

Answer:

Explanation:

Here is the portion of the text from the Declaration of Independence that reflects the Founding Fathers' ideas about the natural rights all people are entitled to:

"We hold these truths to be self-evident, that all men are created equal, that they are endowed by their Creator with certain unalienable Rights, that among these are Life, Liberty, and the pursuit of Happiness."

This passage emphasizes the belief that all individuals are created equal and that their rights are not granted by any government or authority but are inherent and unalienable. The Founding Fathers believed that these natural rights, including the rights to life, liberty, and the pursuit of happiness, are fundamental and should be protected and respected by any just government.

Which 3ways ways in which Soweto protestors harmed their community in their attempt to be public participants

Answers

Soweto protestors inadvertently harmed their community through violence, destruction of property, and disruption of essential services.

While the Soweto protestors were advocating for their rights and seeking to be active participants in public affairs, their actions had negative impacts on their community. One way in which they harmed their community was through acts of violence. During protests, clashes with authorities and instances of rioting occurred, leading to injuries, loss of life, and fear within the community. The violence not only inflicted physical harm but also damaged the social fabric and stability of the community.

Another way the Soweto protestors unintentionally harmed their community was through the destruction of property. Protest actions, such as arson, looting, and vandalism, resulted in the destruction of buildings, public infrastructure, and private property. This not only affected the individuals and businesses directly impacted but also had wider economic consequences for the community as a whole. The destruction of essential facilities, such as schools or medical centers, disrupted crucial services and further disadvantaged the community.

Furthermore, the protestors' actions sometimes led to the disruption of essential services. Road blockades, strikes, and protests that targeted key infrastructure or services, such as transportation or utilities, had unintended consequences for the community. Disruptions to these essential services affected not only the targeted institutions but also inconvenienced and harmed community members who relied on them for their daily needs and livelihoods.

Learn more about crucial here:

https://brainly.com/question/11064580

#SPJ11

TRUE/FALSE. between 2005 and 2007, asphalt firms in kentucky practiced tacit collusion.

Answers

It is True that between 2005 and 2007, asphalt firms in kentucky practiced tacit collusion.

Tacit collusion refers to a situation where competing firms engage in a coordinated behavior that leads to higher prices and reduced competition, without any explicit agreement or communication.

Instead, the firms may use implicit signals or understandings to coordinate their actions, such as following the lead of a dominant firm or matching each other's prices.

Tacit collusion occurs when firms in a market engage in coordinated behavior without any explicit agreement or communication. They might do this by following the actions of a dominant firm or by making strategic decisions based on their understanding of the market.

In the case of asphalt firms in Kentucky between 2005 and 2007, there was evidence of tacit collusion. According to a study by the Kentucky Legislative Research Commission, during this period, asphalt prices increased significantly, and there was a high level of concentration in the market.

The study found that the price increases were not entirely due to the rising costs of raw materials, such as oil. Instead, it was suggested that the high market concentration allowed firms to coordinate their pricing decisions and effectively raise prices without any explicit agreement or communication.

This behavior is consistent with the concept of tacit collusion, where firms in a concentrated market engage in coordinated pricing strategies without explicit communication or agreements.

In the case of the Kentucky asphalt market, the evidence suggests that this type of collusion was practiced between 2005 and 2007.

In conclusion, it is accurate to say that between 2005 and 2007, asphalt firms in Kentucky practiced tacit collusion, leading to increased prices and market concentration during that time period.

For more question on "Kentucky" :

https://brainly.com/question/21606256

#SPJ11

what did charlemagne use as a model for his royal chapel at aachen?

Answers

Charlemagne used the San Vitale Basilica in Ravenna, Italy as a model for his royal chapel at Aachen.

The San Vitale Basilica was known for its octagonal shape, and Charlemagne wanted to replicate this shape in his own chapel. Additionally, Charlemagne was impressed by the mosaics and other decorative elements in the San Vitale Basilica and wanted to incorporate similar features in his chapel.

This choice allowed him to incorporate elements of Byzantine architecture and convey his imperial ambitions, as well as demonstrate his appreciation for the cultural heritage of the Roman Empire. This influence from Byzantine art and architecture helped to establish the Carolingian Renaissance, which was a period of cultural and intellectual revival in Europe during the reign of Charlemagne.

Learn more about San Vitale Basilica:

https://brainly.com/question/30297893

#SPJ11


Other Questions
it is common for a developer to hold back funds before making final payment to ensure that subcontractors perform all work completely. group startstrue or false a 75 year old patient is complaining of shortness of breath. vital signs are bp 160/88, p 130, and r 22 with crackles in the bases of the lungs. you should A client who is anticipating total hip replacement is considering autologous transfusion. When teaching this client about autologous transfusion, it is important to emphasize that?-It reduces the risk of mismatched blood-A hemoglobin level above 9.5 mg/dL is required-there is no need to test the blood for infectious diseases-Donations may be made every other day PWEEZ helpBased on the results of the second simulation, if 224 groups are formed, about how many of them would you expect to contain all girls? Round your answer to the nearest number of groups true/false. the number of levels of observed x-values must be equal to the order of the polynomial in x that you want to fit. If the Watson strand for a double stranded DNA is 5 ATGGTCATGGGTTCCAATGCA 3, what is the sequence of the Crick strand? Find the center of mass of a thin triangular plate bounded by the coordinate axes and the line x + y = 9 if (x,y) = x + y. A)x=2,y=2B) x=54,y=54C)x=98,y=98D)x=1,y=1 Assuming the medium fertility variant, which group of countries will have a decrease in population by 2100, compared to 2015 levels? Choose all that apply.1. Low-income countries2. Lower-middle-income countries3. Upper-middle-income countries4. None of the groups of countries will decrease. A triangle has a side lengths of 21 miles, 28 miles, and 35 miles. Is it a right triangle? Because prices change over time, costs reported for these accounts tend to differ among inventory cost methods A slender bar of mass m and the length l is resting on a smooth horizontal surface, and a horizontal force F is applied perpendicular to the bar at the A. If m = 0.5kg, l = 0.3m, and F = 1.2 N, calculate the magnitude of the acceleration of end B at the instant when F is applied. Present your answer in m/sec^2 . If three-estimate sensitivity analysis is used, an example for which the pessimistic estimate is probably the lowest value is ______________ . A. Alternative life B. Decision node C. First cost D. Replacement machine What are the trends at the individual bank level in the change in the HTM percentage of investments held for large banks from 2013 to 2018 (the period after which the change in regulation took place)? Solve and graph on number line. |6x-3| Which of the following is not a key function of state regulation affecting health insurers and HMOs?A) Licensure of insurers, HMOs and producersB) Plan compliance with Medicare Advantage network adequacy requirementsC) Premium review and approvalD) Consumer ProtectionsE) Financial SolvencyF) Market Conduct Which of the following statements best explains how the Fourteenth Amendment has been interpreted to enhance federal power?The Fourteenth Amendment gave Congress the right to regulate discrimination in statesThe Fourteenth Amendment gave Congress the power to nominate state governorsThe Fourteenth Amendment gave Congress the power to regulate school curriculumThe Fourteenth Amendment gave Congress the power to monitor and regulate voting booths what is the complete ionic equation for the reaction between Na2SO4 and CaCl2 In the diagram below, whatseason is the NorthernHemisphere experiencing whenEarth is in the position indicatedby X?O (A) Fall(B) SpringO (C) SummerO (D) WinterSUN explain why it would be important to evaluate the outcome of a campaign people with damage in the anterior and inferior regions of the temporal lobe suffer _____