Deaths in traffic collisions are rarely linked to the use of alcohol.
A. True
B. False

Answers

Answer 1
false because most crashes are caused by alachol
Answer 2

Answer:

B. False

Explanation:

Deaths in traffic collisions are often linked to the use of alcohol. About 30% of all traffic related deaths have something to do with alcohol.


Related Questions

Law journals

Pepito was part of a crime. He wants to know the difference between principal, accomplice, accessory before the fact and accessory after the fact. Define and explain the difference between them.

Pepito works in a factory in Hialeah that dumps the chemicals used to dye the Cuban flag t-shirts into the adjacent lake. On one sunny Hialeah day, Pepito decides to swim in the lake after work. His skin turns purple and he develops breathing issues after the swim. What can he do? Where can he turn to? What possible legal avenue can he take?

Answers

Answer:

Explanation:

In criminal law, there are a number of different terms used to describe the individuals involved in a crime. A "principal" is the person who actually commits the crime, while an "accomplice" is someone who assists or aids in the commission of the crime. An "accessory before the fact" is someone who helps plan or prepare for the commission of a crime, while an "accessory after the fact" is someone who helps the perpetrator after the crime has been committed.

In the scenario you described, it sounds like Pepito may be an accomplice to the crime of pollution, as he works at a factory that is illegally dumping chemicals into a nearby lake.

As for Pepito, as an employee of the factory, he may have some legal avenues available to him, one would be to speak with a lawyer, who can explain his rights and options under the law. He may also consider filing a complaint with the Environmental Protection Agency (EPA) or other government agency responsible for enforcing environmental laws, or even consider a civil suit against the factory for the harm caused to him.

It's important to note that Pepito's rights and options would be specific to the jurisdiction where the incident occurred and would be better advised by a lawyer, who will be familiar with the specific laws in that area and can guide Pepito with the best course of action.

1 ,Analze the Challenges Opportunities If democracy in your society 2 What is your role to create a good democracy 3. Write and explain some indigenous democratiz Valus that exist in you community​

Answers

There are many difficulties in evaluating a nation's degree of democracy. On what qualities constitute a democracy, there is not always agreement.

Describe three of the obstacles to democracy.

The foundational challenge, the challenge of expansion, and the task of enhancing democracy are the three main challenges. Applying the fundamentals of democratic administration to all religions, diverse social groupings, and numerous institutions is the task of expansion.

What are democracy's three advantages?

Different viewpoints and problems can be settled peacefully.

dignity of the human being.

the ability to freely act, speak, and think (as long as it does not stop others doing the same).

égalité devant la loi.

Safe and secure neighborhood.

To know more about democracy visit:

https://brainly.com/question/14320124

#SPJ1

difference between senators for life and senators by right

Answers

Answer:

Explanation:

Rules are meant to be broken when needed.

When you can't do anything about a situation and the last option is to break the rules. Depending on the time and situation given. You do the crime you do the time. For example. If you had to come up with the money to save your family and time is not on your side the last thing you can do is to steal for the ones you love then if it saves their life wouldn't anyone risk their life for their family? When I say risk their life I mean freedom. We all know the consequences that follow and we will sacrifice our own self to save those we love especially our children/our loved ones people who mean everything to us. If we had no choice given and we tried our best to get help from everyone to anyone but no one was there to help what else can you/we do?

Now this isn't always the best thing to do in some scenarios but as long as breaking the rules don't involve hurting anyone or taking someone's life away I'm sure that if it saves a life or many lives then yes rules are meant to be broken. I would break it if needed just to save many or even just 1 life because 1 matters.

Anyways RULES should stay the way it is it has worked for so long but there are just some that need to be looked into that may need a little bit of tweaking. The rule-makers knows whats best for the people I'm sure they did not just get to where they are at without the knowledge and experience and I'm sure they also had to live the way others did in order to experience what others are experiencing they can even be beside us and we don't even know it. To know what rules are to be broken you must first experience the reasoning as to why they had to be broken. The reasonings vs the excuses. Which one outweighs is there's a will there's a can. You will do your hardest to succeed in life by obeying rules along the way. Rules are there not to keep us in line but to help us along the way. We have our own will our own rights and the knowledge to know what is wrong or right we also are given the feeling that we have felt in our journey and we know when something seems to be off or wrong like Spiderman we get these senses. A666nd it is up to us to follow it. Our intuition plays a big part you will sense things that makes eye doesn't see this is when your body mind and soul aligns and when it does you just know and feel that you must do what you believe is right even thou you know that it may break some rules but you just know that you need to it because you can see it by the experience you have encountered and the knowledge you have learned from it. And when you feel that something just isn't right or you just feel that it's needed you go with your feeling and what you believe. And because you believe you need to see for yourself that what you feel is right so you go blindness into the unknown and you hope that you are right and if you arnt well atleast you went with what you believe in and now you know. Atleast it was your own choice. So let me ask now thesame questions are rules meant to be broken? Yes they are but that's the test of life the questions we should ask is. What are you willing to sacrifice? Your freedom? Or the freedom of others? If you can make a difference and if you had to endure all the pain and suffering to change something wouldn't you sacrifice yourself if it helps all of us? If it can make a difference?

Higher doses of Barbiturates results in  aggressive behavior erratic driving both neither

Answers

Barbiturates at higher doses impair thinking and weaken coordination. So it is bound to lead to both aggressive behavior and erratic driving.

What are Barbiturates?

A class of medications known as barbiturates has sedative effect on the body. Similar to alcohol, they can have effects that range from a mild relaxation to the inability to perceive pain and even unconsciousness.

The German Bayer laboratory created the first barbiturates in the 1860s. Barbiturates boost the activities of a brain chemical involved in signal transmission. The name of this substance is gamma amino butyric acid (GABA).

What are the effects of Barbiturates?

They serve as a drug to ease anxiety, stop seizures, and promote sleep.

They have recreational drug effects that are comparable to that of alcohol:

exhilaration and relaxationlowered inhibitionunclear speechloss of coordination and poor decision-makingconfusion

Barbiturates might vary in their onset time and their duration of action. They come in four different acting lengths: super short, short, moderate, and long. Barbiturates have an effect on the body within 30 minutes of ingestion and last for 4 to 16 hours.

To know more about Barbiturates, check out:

brainly.com/question/1083849

#SPJ1

Did Ohio's criminal syndicalism law, prohibiting public speech that advocates various illegal activities, violate Brandenburg's right to free speech as protected by the First and Fourteenth Amendments?

Answers

Yes, the Ohio criminal syndicalism law was found to violate Brandenburg's right to free speech as protected by the First and Fourteenth Amendments. In the landmark Supreme Court case Brandenburg v. Ohio (1969), the Court ruled that the Ohio law, which prohibited public speech that advocates various illegal activities, was unconstitutional because it was overly broad and violated the First Amendment's guarantee of freedom of speech. The Court held that speech can only be restricted if it is intended to produce "imminent lawless action" and is likely to do so. The Court's decision in Brandenburg v. Ohio established the "Brandenburg test," which is still used today to determine when speech can be restricted based on its content.

Why was the identification of happiness with pleasure one of the most controversial aspects of utilitarianism?

Answers

Utilitarians believe that the purpose of morality is to make life better by increasing the amount of good things (such as pleasure and happiness) in the world and decreasing the amount of bad things (such as pain and unhappiness). They reject moral codes or systems that consist of commands or taboos that are based on customs, traditions, or orders given by leaders or supernatural beings. Instead, utilitarians think that what makes a morality be true or justifiable is its positive contribution to human (and perhaps non-human) beings.

Natural resources list at list 10​

Answers

Here are ten natural resources:

1. Water

2. Timber

3. Coal

4. Oil

5. Natural GasIron

6. Ore

7. Copper

8. Gold

9. Silver

10. Uranium

Drag the tiles to the correct boxes to complete the pairs.
The Founders were wary of any one group or person having too much power. Each branch of government was carefully defined with limits to its
powers. Pair the people of Congress to their powers
Speaker of the
House
Senators
Majority Leaders
Representatives
make laws, create taxes, spend money, impeach officials
lead the house, take over the presidency if the Vice President is not able
appoint heads and members of committees, lead sessions of Congress
confirm nominations, create treaties, hold impeachment trials

Answers

According to the question, The legislative, executive, and judicial branches make up the three parts of the federal government of the United States.

The federal government consists of what?

The U.S. Constitution grants Congress, the Presidents, and the Federal judges, respectively, the authority to act as the legislation, executive, and judicial departments of the federal government.

What function does the federal government serve?

Just one federal government has the power to control domestic and international trade, declare war, and establish other national policies like as taxation and spending. Legislation from Congress, which consists of the 100-member U.S. Senate and the individuals with unique House of Representatives, is frequently the first step in these procedures.

To learn more about federal government visit:

https://brainly.com/question/860014

#SPJ1

Answer:

In the image

Hope this helps!

Explanation:

Using the drop-down menus, choose the right government service to complete each sentence.

Providing a free public education for all children is an example of supporting______ .
Fighting fires is one way in which the government ensures for citizens_______.
Building roads and power systems are ways the government provides_______.

Answers

Answer:

Four major facilities are as follows:-

(i) Basic education Government provides school and other educational facilities like chair, books etc. to be used by the public. But its use and performance are depended on collective response and community cooperation.

(ii) Basic health facilities Government provides hospitals, vaccine programmes to maintain the basic quality of life.

(iii)Law and order facility/security the more the country will secure, the more it will attract investment public by which people can live peacefully.

(iv) Provide for Public Distribution System: Government opens PDS shops or ration shops through which it supplies basic food items like rice, wheat, pulses, etc. at very low price/subsidised rate to the lower income group or poor people. But the functioning of these facilities depends on the community awareness and public cooperation. Other facilities are infrastructure facilities like road, irrigation projects drinking water supplies.

(v) Healthcare: The government provides us with hospitals and dispensaries. They also maintained facilities like doctors and diagnostic machines.

(vi) Banking facilities: To make our money safe and to get loans, banks are there.

(vii) Roads and highways: To go anywhere easily, roads and highways are there

Why are tax policies that cut taxes called trickle-down economics?
1. because the benefits are supposed to filter down to workers
2. because the benefits become less pronounced at every level
3. because the benefits are intended to help only the wealthy
4. because the benefits quickly cause a positive effec

Answers

Answer:

Explanation:

Trickle-down economics, also known as supply-side economics, is a theory that argues that cutting taxes on the wealthy and businesses will lead to greater economic growth, which in turn will benefit everyone in the economy, including workers and lower-income individuals. The theory is based on the idea that if the wealthy and businesses have more money, they will invest it in ways that create jobs and stimulate economic growth. The theory is also known as "the trickle-down theory" due to the belief that the benefits of tax cuts will "trickle down" to the rest of society.

So the reason why tax policies that cut taxes called trickle-down economics is 1. because the benefits are supposed to filter down to workers

In chromatography, scientists use chemicals that can separate the parts of the mixture. These chemicals are called _______. (eight letters)

Answers

Answer:

Explanation:

In chromatography, the chemicals that are used to separate the components of a mixture are called "solvents".

The process works because different compounds in the mixture have different affinities for the stationary phase and the mobile phase. The stationary phase is usually a solid or a liquid that is immobile and the mobile phase is a liquid or a gas that is continuously flowing.

The solvent is the liquid that is used as the mobile phase. It is passed through the stationary phase, which can be a solid or a liquid, and the components of the mixture are separated based on their interactions with the stationary and mobile phases.

There are several types of chromatography that use different solvents and stationary phases, such as:

Thin Layer Chromatography (TLC) uses a thin layer of silica or alumina on a glass plate as the stationary phase, and a solvent such as ethyl acetate or hexane as the mobile phase.

Gas Chromatography (GC) uses a solid stationary phase such as a porous beads, and the mobile phase is a gas such as helium, hydrogen or nitrogen.

High Performance Liquid Chromatography (HPLC) uses a liquid stationary phase, which is usually a chemically-bonded silica, and solvents such as acetonitrile, methanol or water as the mobile phase.

Each of these methods can separate different compounds based on their chemical and physical properties, thus making it possible for scientists to identify and quantitate the components of a mixture.


4. If you get on an airplane and take a flight that
doesn't leave the country it is called a
flight.
domestic
foreign

Answers

Answer:

If you get on an airplane and take a flight that doesn't leave the country it is called a domestic flight.

Explanation:

A domestic flight is within the country while a foreign flight leaves the country.

the flight Is Called a domestic flight

Bicycles are not considered vehicles because they can also ride on sidewalks.
A. True
B. False

Answers

Answer:

B. False

Explanation:

Bicycles are generally considered vehicles and are subject to the same rules of the road as other vehicles.

Police Stress: There are four types of police stress listed in the textbook and lecture notes. In your own words, explain one of the four police stressors and provide an example (fiction or non-fiction).


Recommendation: What do you recommend police do to reduce their stress? Focus on the stress you explained in your response to A. Be specific and creative (money and time do not matter).


4 TYPES OF POLICE STRESS ARE : External Stress, Organizational Stress, Personal Stress, and Operational Stress.


!PLEASE I NEED HELP! PLEASE HELP ME! DUE IN 30 MINUTES PLEASE!! PLEASE! I'LL GIVE YOU A CROWN AND MORE POINTS!

Answers

Operational Stress is caused by the day to day operational challenges police face such as dealing with hostile and dangerous situations, long work hours and working under extreme pressure. An example of operational stress is when a police officer responds to a high-stakes call in which a suspect has taken hostages and the police officer needs to safely deal with the situation and rescue the hostages.

Police should take steps to reduce operational stress such as taking proper breaks during their shifts, engaging in physical activity to reduce stress, receiving mental health services, seeking support from a colleague if they are feeling overwhelmed, and having an open dialog with their supervisors. By taking these steps, police can better manage their operational stress, allowing them to maintain a healthy work-life balance and allow them to focus on their duties.

How do you distinguish ethics from morals?

Answers

ethics are the rules you follow or abide by to remain in a community (example is following the rules and teachings of religion to stay in the fold of it) and morals are you personal values and probably sticking to principles

At which of the following BAC levels are motor coordination skills, judgment, and self-control impaired?

.08
.15
.30
.60

Answers

At the BAC levels of 0.15, individuals have their are motor coordination skills, judgment, and self-control impaired. The Option B is correct.

What are some effects at Specific BAC?

Individual differences among users have a significant impact on the effects of alcohol intoxication. Some users may become intoxicated at much lower levels of Blood Alcohol Concentration (BAC) than shown.

No loss of coordination, slight euphoria, and loss of shyness at 0.02-0.03 BAC. There is no evidence of depressive effects. Mildly relaxed and possibly a little dizzy.BAC 0.04-0.06: A sense of well-being, relaxation, lower inhibitions, and a sensation of warmth. Euphoria. Some minor impairment in reasoning and memory, as well as a reduction in caution. 0.07-0.09 BAC: Impaired balance, speech, vision, reaction time, and hearing. Euphoria. Judgment and self-control are impaired, as are caution, reason, and memory. 08 is legally impairing and illegal.

0.10-0.125 BAC: We have significant impairment of motor coordination and loss of good judgment.

0.13-0.15 BAC: Gross motor impairment and lack of physical control. Blurred vision and major loss of balance.

Read more about BAC levels

brainly.com/question/13614186

#SPJ1

why is the use of carbon-14 dating limited

Answers

The reason why the use of carbon-14 dating is limited  are :

Time rangeSample size

What is carbon - 14 dating ?

Carbon-14 dating, also known as radiocarbon dating, is a method used to determine the age of organic materials, such as wood, bone, and shells. It is however limited.

Carbon-14 dating is only useful for dating materials that are up to about 50,000 years old. Beyond that, the amount of carbon-14 remaining in the sample is too small to be accurately measured.

Carbon-14 dating requires a relatively large sample size, usually at least a few grams, in order to obtain an accurate date. Smaller samples may not yield enough carbon-14 to be dated effectively.

Find out more on Carbon - 14 dating at https://brainly.com/question/14879102

#SPJ1

I need helppp
I don’t remember how to do this and this whole packet is do Thursday

Answers

Answer:

hi this is bing chiling

Explanatio

How court decisions have dynamically altered the American political landscape?

Answers

Court decisions have played a significant role in shaping the American political landscape. Through their interpretation of the Constitution and other laws.

What are some of the key examples of court decisions that have dynamically altered the American political landscape?

The concept of judicial review was established in Marbury v. Madison (1803), which provides the courts the authority to examine the legality of legislation passed by Congress and the executive branch's activities.

The power balance between the executive and legislative branches of government has been shaped by this choice throughout American history.

Dred Scott v. Sandford (1857) that upheld the legality of slavery, denied citizenship to African Americans and this has increased the tension and led to Civil War in 1861.

In the landmark case of Brown v. Board of Education in 1954, segregation in public schools was ruled to be unconstitutional. This significant ruling contributed to improve racial equality in the United States and was a major success for the Civil Rights Movement.

Roe v. Wade (1973) established the constitutional right to privacy and struck down state laws that banned abortion in the first trimester of pregnancy, this decision has been the subject of ongoing political and cultural debate.

To know more about constitution visit:

https://brainly.com/question/29799909

#SPJ1

SkillsUSA is an organization made up of high-level college entry personnel who use their skills to enable students to enter prestigious colleges.
A. True
B.False

Answers

Skills USA is an organization made up of high-level college entry personnel who use their skills to enable students to enter prestigious colleges.

The statement is True

What do such organization do?

The middle-school, high-school, college, and postsecondary students served by SkillsUSA, a nonprofit national association for education, are those pursuing careers in skilled trade, technical, and service occupations.The main organization that assists students in their preparation for technical, skilled, and service vocations is called SkillsUSA. One of the most deliberate actions you can make in your professional career is to serve as an advisor to a SkillsUSA branch.Benefits of Membership: Gain and build academically-based personal, professional, and technical skills. Obtain entry to privileged scholarship possibilities. Gain recognition by competing in local, state, and national career competition programs offered by SkillsUSA.

To  know more about college here

https://brainly.com/question/25567167

#SPJ1

What is MOST likely to happen when a bullet is fired 12 to 18 inches from a target?

Answers

Answer:

It is likely that the bullet will hit the target. However, it is also possible that the bullet could miss the target or that the bullet could ricochet off the target.

Explanation:

It is not possible to accurately predict what will happen when a bullet is fired from a gun, as the outcome will depend on a variety of factors such as the type of gun and bullet being used, the distance from the target, and the target itself.

In general, if a bullet is fired from a gun at a distance of 12 to 18 inches from a target, it is likely that the bullet will hit the target. However, it is also possible that the bullet could miss the target or that the bullet could ricochet off the target. It is important to exercise caution when handling firearms and to always follow safety guidelines to minimize the risk of injury or accidents.

In at least 150 words, evaluate the effectiveness of the Supreme Court In extending libertles outlined in the Constitution
to all U.S. citizens. Give an example.

Answers

Answer:

5

Us.Citizen is are good people.

What is the difference between bias and perspective, if there is a difference, and how can/should they be handled differently?

Answers

Bias and perspective are two terms that are often used interchangeably but they are slightly different. Bias is an inclination that someone has towards a certain idea or opinion based on preconceived notions or a personal opinion. Perspective is how someone views a specific situation, which is based on a combination of many influences including beliefs, values, and experiences.

Bias should be handled by listening to the argument of others nonjudgmentally, understanding the evidence that is being presented, and striving to make unbiased decisions or conclusions. Perspective is best handled by actively listening and considering the ideas of others without judgement, then working together to reach an opinion that is inclusive of all perspectives.

Which of the following is NOT one of the punishments for speeding?

Answers

Answer:

Explanation:

Every human is bound by the rules of society. We are expected to follow the rules, be it family, school, college, office, etc. On an individual level, rules help us in conducting our lives in a meaningful way. They put limits on our actions. Rules guide our behavior and actions. On a societal level, rules facilitate the better organization of every stakeholder. Rules are like codes of conduct for society. They promote harmony, cooperation, equality, etc. No society can sustain without rules. Hence, ensuring that rules are properly followed is important. Punishment is one of the means to achieve the goal of a rules led society. Punishment acts as a deterrence against violation of rules. For example, fines are imposed on people violating traffic rules. The imposition of fines is a tool of punishment and it motivates the public in obeying traffic rules. Obeying rules led to discipline in one's life. They guide every action and avoid dilemmas. In a work, coordination is very crucial and having specific guidelines promotes coordination. A proper rule based work culture diminishes chaos, encourages discipline, and boosts efficiency.

Q01: Select the best answer. Which of the following does a DO NOT ENTER SIGN
keeps you from entering? P. 6
O A. A road
OB. A Freeway
O C. Both A & B
O D. None of the above

Answers

Answer:

The answer is C. Both a road and a freeway can keep you from entering.

Explanation:

It is most likely that the answer is C, both a road and a freeway. This is because both can keep you from entering, whether it is because there is a barrier or because the road is too busy.

analyze karl marx's impact on the former soviet union. how did his influence on the soviets affect the US free-enterprise system?

Answers

Answer:

Please read below

Explanation:

Karl Marx had a profound impact on the former Soviet Union. His writings and teachings provided the ideological framework for the Bolshevik Revolution of 1917, which brought the Soviet Union into being. Marx's writings on dialectical materialism and historical materialism served as the basis for Soviet ideology and the Marxist-Leninist interpretation of history.

Marx's influence on the Soviet Union was felt in many aspects of its political and social life. Marxist-Leninist principles guided the Soviet state in its decision making, economic policies, and foreign policy. The Soviet Union was a centrally-planned economy with a focus on heavy industry, collectivization of agriculture, and the elimination of private property and the free market.

The influence of Marx's ideas on the Soviet Union had a significant impact on the US free-enterprise system. The Soviet Union represented a direct challenge to the capitalist model of economic development and the US government was determined to contain the spread of communism. This led to numerous Cold War policies and a massive military build-up. Furthermore, the success of the Soviet Union in building a powerful and modern economy was an example for other developing countries to follow, which further threatened US dominance in world markets.

I solo, could you possibly logically prove me wrong?

Answers

Answer: No, it is not possible to logically prove someone wrong when they are making a statement about their own opinion or experience.

Explanation:

Answer:

No.

Explanation:

You're welcome.

Gabriel wants to be a police officer when he grows up and knows he needs to develop his skills so he can best serve his community when it's time to
enroll in the police force. He heard about the Law Enforcement Explorer Scouts at a local convention. As the spokesperson, what is a talking point you
would NOT go over with Gabriel about the organization?
A. The organization places a special emphasis on respect for the law, physical fitness, positive citizenship, and patriotism
The organization uses character-building experiences and mentorship to help build members' full potential
C. The organization focuses on getting students ready for a career in social work
D. The organization facilitates character development and the development of strong personal values
B.

Answers

Option b is not related to law enforcement Explorer Scouts at a local convention.

What about Law Enforcement Exploring?

Young adults who participate in Law Enforcement Exploring, sometimes known as "Police Explorers," get the chance to collaborate with local law enforcement organisations to learn more about a career in law enforcement. The Boy Scouts of America's Learning for Life, a non-Scouting division, established it on July 12, 1973. It is one of their Exploring programmes. Generally, young adults between the ages of 14 and 21 who meet the program's eligibility requirements and have completed their eighth grade can apply.

The Exploring programme underwent a division in 1998. All of the career-focused positions were transferred to Learning for Life, while the remaining positions were included into the new Venturing (Boy Scouts of America) programme. Young men and women between the ages of 14 and 20 can now participate in the worksite-based job education programme Exploring.

To know more about law enforcement Explorer, visit:

https://brainly.com/question/462905

#SPJ1

Which of these is NOT an official responsibility of a member of the President’s Cabinet?
Answer choice in image.

Answers

Since members of the presidents cabinet are usually individuals of great ability but little to no political power their primary functions are to effectively run a department and advise the president so i would say B helping raise money for the presidential election campaign, thats my best guess as their three main functions are

• directing government policy and making decisions about national issues.

• spending a lot of time discussing current national problems and how these can be solved.

• presenting bills – proposed laws – from their government departments.

Why is it important to have media coverage of government elections?
O It may be the only accessible source of information on the issues and candidates for a particular group of people.
O It helps people have a comprehensive understanding of all of the issues.
It introduces the public to only the candidates who have the best chance of winning.
• It encourages people to vote for the right candidate based on the media's informed opinions.

Answers

Answer: There are several reasons why media coverage of government elections is important:

Media coverage helps inform the public about the candidates and the issues at stake in the election. This allows voters to make informed decisions about who to vote for and what policies to support.

Media coverage helps ensure transparency and accountability in the electoral process. By reporting on the elections, the media can help expose any wrongdoing or malfeasance that may occur.

Media coverage of elections can help promote public engagement and participation. By providing information about the elections and encouraging discussion of the issues, the media can help increase turnout and ensure that the election reflects the will of the people.

Media coverage can also help ensure that the results of the election are widely accepted as legitimate. By providing objective and unbiased reporting, the media can help build confidence in the electoral process and reduce the likelihood of disputes or challenges to the results.

It important to have media coverage of government elections because It helps people have a comprehensive understanding of all of the issues. Thus, option B is correct.

Why media coverage is important?

The public is more informed about the candidates and the election's key concerns thanks to media coverage. This makes it possible for people to decide who to vote for and what policies to support after doing their research. The electoral process is made more transparent and accountable thanks to media coverage.

The media can aid in exposing any potential impropriety or misbehavior by covering the elections. Election coverage in the media might encourage voter participation. The media can help boost turnout and guarantee that the election reflects the will of the people by disseminating information about the elections and promoting discussion of the topics. The acceptance of the election results as legitimate can also be increased through media coverage. By delivering unbiased and objective reporting.

Therefore, we can conclude that option B is correct.

Learn more about media coverage here:

https://brainly.com/question/1212542

#SPJ5

Other Questions
in a company, 60% of workers are women. if 800 people work on the company who aren't women, how many workers are there in all? use pencil and paper. show two different ways that you can solve this problem. how many workers in all? A college biology lab selected 65 women and 65 men at random and recorded their body temperatures (in degrees Fahrenheit). The distributions of their temperatures are shown below.Which statement gives an accurate comparison of the body temperatures of women and men shown?Question 5 options:1.)The mean body temperature for women is less than for men and women's temperatures vary more than men's temperatures.2.)The mean body temperature for women is greater than for men and women's temperatures vary less than men's temperatures.3.)The mean body temperature for women is less than for men and women's temperatures vary less than men's temperatures.4.)The mean body temperature for women is greater than for men and women's temperatures vary more than men's temperatures. A rise in oil prices has caused input prices to increase throughout the economy, causing nominal GDP to increase by 13%. Meanwhile, the price level decreases by 2%. What is the real GDP growth rate during this period Robin tosses a pair of 6-sided dice. The odds in favor of the sum of the 2 dice rolls being greater than 8 are 5:13.What is the probability that the sum of the 2 dice rolls will not be greater than 8? DefinitionUnit 6 Vocab: DNA, RNA, and Protein Synthesisnucleic acid molecule that allows for the transmission of genetic information anprotein synthesisYour answer What are the 4 names of an angle? Tech A says that all hazards can be removed from a shop. Tech B says that you should disconnect an air gun before inspecting it. Who is correct A follow-up experiment revealed that the genetic content of the bacterial cells was altered by the transfer of material from the phage. This process is best described as: PLEASE HURRY AND HELP!!!Which of the following tables represents a linear relationship that is also proportional?x y0 33 66 9x y0 42 64 8x y0 06 312 6x y0 35 510 7 what are the two quantities in this module for which we will develop unit factors to do dimensional analysis with chemical substances? Spring and Summer can alsosymbolize marriage ortogetherness. Which of thefollowing pairs was NOTbrought together in some wayduring Acts IV-V of "TheWinter's Tale"? At the places where 180 degrees of longitude and the International Date Line meet, there is a change of _________ as you cross the International Date Line. Termination of the postsynaptic potential would be expected from a drug or process that acts to a. blocks transport of the neurotransmitter molecule through the axon membrane. b. enzymatically degrade the neurotransmitter molecule. c. increase the number of postsynaptic receptors. d. increase release of the neurotransmitter. e. increase synthesis of the neurotransmitter molecule. When two lines make an angle of 90 degree is known as? Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA Helllllp please ???? Which of the following occurs when a person reaches the age of majority and states, either orally or in writing, that he or she intends to be bound by the contact entered into as a minor?Multiple ChoiceDisaffirmanceImplied novationImplied ratificationExpress novationExpress ratification What is the area of equilateral having side 12 cm? What is the value FG? solve the equation a^2x^2 = abx + 2b^2 using completing the square method