HELP!!!! NUMBER 2

2. Find the distance between these two points.
First Point
Second Point
Distance
(5, - 2)
(8,6)
(5,6)
(-3,6)
(-3,6)
(5,-2)

HELP!!!! NUMBER 22. Find The Distance Between These Two Points.First PointSecond PointDistance(5, - 2)(8,6)(5,6)(-3,6)(-3,6)(5,-2)

Answers

Answer 1

Answer:

1. 8

2 . 11

[tex]3 . \sqrt{128} \ or \ 8 \sqrt2[/tex]

Step-by-step explanation:

[tex]Distance = \sqrt{(x_2 -x_1)^2 + (y_2 - y_1)^2 }[/tex]

1 . ( 5 , - 2 ) and ( 5 , 6 )

  [tex]Distance = \sqrt{(5 -5)^2 + ( 6-(-2))^2} = \sqrt{ 0 + 8^2 } = \sqrt{64} = 8[/tex]

2 . ( 8 , 6 ) and ( - 3 , 6 )

  [tex]Distance = \sqrt{( -3 -8)^2 + ( 6 - 6)^2 } = \sqrt{ (-11)^2 + 0 } = \sqrt { 121 } = 11[/tex]

3. ( 5 , - 2 ) and ( -3 , 6 )

  [tex]Distance = \sqrt{(-3 - 5)^2 + ( 6 --2)^2} = \sqrt{(-8)^2 + ( 8)^2} = \sqrt{ 64 + 64 } = \sqrt{128}[/tex]

   

          [tex][ \ \sqrt{128} = \sqrt{ 2 \times 64} = \sqrt{ 2 \times 8^2 } = 8 \sqrt{2} \ ][/tex]


Related Questions

What percentage of total hours was spent playing football

Answers

Answer:  20

Explanation:

10 hours was spent playing football, out of 50 total

10/50 = 1/5 = 0.20 = 20%

Name the
alternate
interior angle
with angle 5.
HELPP PLEASEEE

Answers

Answer:

angle 4 isthe correct answer

The cost of making 6 chairs is $410. The cost of making 22 chairs is $570.
What is the cost per chair?
What is the fixed cost (or startup cost) that you need to spend before making the first chair?
Write a linear equation that tells you the total cost, C. of making x chairs.
CE
What is the total cost of making 17 chairs? $
If your total cost is $820, how many chairs did you make?

Answers

Answer:

if it cost 410 dollars to make 6 chairs we can divide 410 by 6 which is 68.3333333333 or 68 1/3

now for the other set of chairs we can divide 570 by 22 which is

25.9090909091 or 25.9

and for the rest it doesn't make any sense to me sorry

What is the monthly payment on a 15-year loan of $57,900 if the annual interest rate is 12%?​

Answers

The answer is $457 a month

You recently invested $400,000 of your savings in a security issued by a large company. The security agreement pays you 12% per year and has a maturity of five year from the day you purchased it. What is the total cash flow you expect to receive from this investment, if compounded quarterly, separated into the return on your investment?

Answers

Answer:

$722444.49386776

Step-by-step explanation:

Use Compound Intrest Formula

[tex]a = p(1 + \frac{r}{n} ) {}^{nt} [/tex]

where p is the original amount.R is the amount of percentage compoundedN is amount of times compounded per year.T is how long the interest last.

P is 400,00p

T is 12% or 0.12

N is 4 since it is compounded quarterly

T is 5.

Plug the values in

[tex]400000(1 + \frac{0.12}{4} ) {}^{20} [/tex]

Ypu get

$722444.49386776

In a binomial experiment :________

a. the probability does not change from trial to trial
b. the probability does change from trial to trial
c. the probability could change from trial to trial, depending on the situation under consideration
d. None of these alternatives is correct.

Answers

Answer:

Hence the correct option is Option (a).

Step-by-step explanation:  

Option (a) is correct.  

The probability does not change from trial to trial.  

p = Probability of sucess.

geumath malah 17.pdf
1/21
* 16 The diagram shows a swimming pool in the shape of a prism.
10 m
Sm
Diagram NOT
accurately drawn
וו 1
2 m
4m
DO NOT WRITE IN THIS AREA
2 m
The swimming pool is empty.
Water from 3 water tankers is going to be put into the pool.
There are 20000 litres of water in each water tanker.
Sam thinks that the surface of the water in the pool will be 10 cm below the top of the pool.
Is Sam correct?
You must show how you get your answer.
(lm - 1000 litres)
TE IN THIS AREA

Answers

Answer:

He is wrong.  

In my answer I found the complete volume of the pool and then what the volume would be 10 cm empty.  You probably only need to find the 10 cm emptied  to answer, just a heads up.  if you have any questions though let me know.

Step-by-step explanation:

To most easily figure out the volume of the empty pool I think it is easiest to break it up into four parts..

First break off that skinny end bit so it will have 1 m in height, 4 m in length and 5m in width.  Width is never going to shange because of how we are breaking this up, and the width is the distance from you into the paper, if that makes sense.  Basically not up and down or left and right.

Next another rectangular prism  from the right side with 2 height, 2m length and again 5m width.

Now you have a trapezoidal prism with one base of length 1m, another of base 2m and a height of length 4m.

To fond the volume of prisms you want to find the area of their bases then multiply it by their heights.  In this instance height is going to be the width again, and the bases are th parts facing us on the picture.

For a rectangular prism area of the base is easy, just multiply length by height.  a trapezoid is taking the two bases (b1 and b2) ading them together and dividing that sum by 2, THEN taking this new number and multiplying it by what would be the height of the trapezoid.  the trapezoid has its bases as two heights, and its height then would be the horizontal length of the pool.  Sorry if that is confusing.  Here are the three volumes though.

Rectangular 1: 4*1*5 = 20 m^3

Rectangular 2" 2*2*5 = 20m^3

Trapezoidal: = ([1+2]/2)*4*5 = 30 m^3

So total it is 70 m^3

The question then says each cubic meter can contain 1,000 liters of water.  70 m^3 then is 70,000 liters

The question also says there are three barrels of 20,000 liters each, so combined that's 60,000 liters.

Finally it wants to know if Sam is right saying if you dump all of the 60,000 liters into the pool the surface of the water will not reach the top of the pool by 10 cm.  60,000 is less than 70,000, but we don't know how much lower it is in cm.  

The trick here is to know that we are lowering a specific dimension of each prism to a certain amount to be lower by 10cm

In the 4x1x5 rectangular prism the 1m side is lowering.

In the 2x2x5 rectangular prism  the 2m side representing the vertical length is getting some amount taken away.

int he trapezoidal prism both of the "bases" are getting an amount taken.

So the trick here is to set up the math again, except this time with 10 cm less being subtracted from each part, then solving t and see if it gets us the 60,000 liters or 60 m^3.  Since we are measurng in meters, 10 cm less is the same a subtracting .1, or if you prefer subtracting a decimeter.

4*1*5 becomes 4(.9)5 = 18

2*2*5 becomes 2(1.9)5 = 19

Trapezoidal: = ([1+2]/2)*4*5 becomes ([(.9)+(1.9)]/2)*4*5 = 28

Adding this all together gets us 65 or 65,000 liters.  This means that if the pool is filled 10 cm from the top the volume would be 65,000 liters, still more than if the three tankers are emptied completely into it.  

You could have probably just done the second part, where we sbtracted 10 cm from each of the dimensions, but I am going to leave it all since I wrote it.

9514 1404 393

Answer:

  Sam is not correct.

Step-by-step explanation:

As shown in the attachment, the "base" (front face) of this prism can be divided into a rectangle and a trapezoid. The relevant area formulas are ...

  A = LW . . . . area of a rectangle of length L and width W

  A = 1/2(b1 +b2)h . . . . area with parallel bases b1 and b2 and height h

__

The rectangle portion of the "base" of the pool has area ...

  A = (10 m)(1 m) = 10 m²

The trapezoid portion of the "base" of the pool has area ...

  A = 1/2(6 m +2 m)(1 m) = 4 m²

Then the "base" area is ...

  B = 10 m² +4 m² = 14 m²

__

The volume of the prism is given by ...

  V = Bh . . . . where B is the base area and h is the distance between bases

  V = (14 m²)(5 m) = 70 m³

We are told that 1 m³ = 1000 L and that 3 tankers of 20,000 L each are emptied into the pool. That leaves an unfilled volume of ...

  70 m³ -3×(20 m³) = 10 m³ . . . . unfilled volume

__

The surface area of the pool is ...

  A = LW = (10 m)(5 m) = 50 m²

So the unfilled volume has a height of ...

  V = Bh

  10 m³ = (50 m²)h

  h = (10/50) m = 20/100 m = 20 cm . . . . . the height of the unfilled space

The water in the pool will be 20 cm below the top, not 10 cm. Sam is not correct.

The radius of a circle is 12.4 cm. Find the circumference to the nearest tenth.

Answers

77.9 cm should be the answer


In order for the data in the table to represent a linear
function with a rate of change of +5, what must be the
value of a?

Answers

Answer:

Step-by-step explanation:

Answer: C) a=18

Step-by-step explanation: Hope i helped :)

If paper was £1.99 a pack and is now £3.98 a pack, what is the percentage increase in the price of the product?

Answers

Answer:

100%

Step-by-step explanation:

The initial price of the paper = 1.99

The final price of the pack of paper = 3.98

We need to find the percentage increase in the price of the product. It can be solved as follows :

[tex]\%=\dfrac{3.98-1.99}{1.99}\times 100\\\\=100\%[/tex]

So, the percentage increase in the price of the product is 100%.

A man is changing the oil in his car. The instruction manual indicates that the car hold pints of oil. The man only has a cup measure. How many cups equal three pints?

Answers

The volume contained in a cup of oil is a fraction of the volume

contained in a pint of oil.

Correct response:

6 cups

Method used for the above unit conversion

The measure of the volume of oil the car holds = Pints of oil

The measurement the man has for use = Cups of oil

Required:

The number of cups equal to three pints.

Solution;

1 pint of oil = 2 cups of oil

Therefore;

3 pints of oil = 3 × 2 cups of oil = 6 cups of oil

The number of cups of oil equal to 3 pints of oil is 6 cups of oil

Learn more about units conversion here:

https://brainly.com/question/4845674

A box has two balls, one white and one red. We select one ball, put it back in the box, and select a second ball (sampling with replacement). Find the probability of the following events:
a. Let F = the event of getting the white ball twice.
b. Let G = the event of getting two balls of different colors.
c. Let H = the event of getting white on the first pick.
d. Are F and G mutually exclusive?
e. Are G and H mutually exclusive?

Answers

Answer:

See explanation

Step-by-step explanation:

Given

Represent the balls with the first letters

[tex]W =1[/tex]

[tex]R =1[/tex]

Solving (a): P(F) --- White balls twice

The event of F is:

[tex]F = \{(W,W)\}[/tex]

So:

[tex]P(F) = P(W) * P(W)[/tex]

[tex]P(F) = \frac{n(W)}{n} * \frac{n(W)}{n}[/tex]

[tex]P(F) = \frac{1}{2} * \frac{1}{2}[/tex]

[tex]P(F) = \frac{1}{4}[/tex]

Solving (b): P(G) --- two different colors

The event of G is:

[tex]G = \{(W,R),(R,W)\}[/tex]

So:

[tex]P(G) = P(W) * P(R) + P(R) * P(W)[/tex]

[tex]P(G) = \frac{n(W)}{n} * \frac{n(R)}{n} + \frac{n(R)}{n} * \frac{n(W)}{n}[/tex]

[tex]P(G) = \frac{1}{2} * \frac{1}{2} + \frac{1}{2} * \frac{1}{2}[/tex]

[tex]P(G) = \frac{1}{4} + \frac{1}{4}[/tex]

[tex]P(G) = \frac{1}{2}[/tex]

Solving (c): P(H) --- White picked first

The event of H is:

[tex]H = \{(W,R),(W,W)\}[/tex]

So:

[tex]P(H) = P(W) * P(R) + P(W) * P(W)[/tex]

[tex]P(H) = \frac{n(W)}{n} * \frac{n(R)}{n} + \frac{n(W)}{n} * \frac{n(W)}{n}[/tex]

[tex]P(H) = \frac{1}{2} * \frac{1}{2} + \frac{1}{2} * \frac{1}{2}[/tex]

[tex]P(H) = \frac{1}{4} + \frac{1}{4}[/tex]

[tex]P(H) = \frac{1}{2}[/tex]

Solving (d): F and G, mutually exclusive?

We have:

[tex]F = \{(W,W)\}[/tex]

[tex]G = \{(W,R),(R,W)\}[/tex]

Check for common elements

[tex]n(F\ n\ G) = 0[/tex]

Hence, F and G are mutually exclusive

Solving (e): G and G, mutually exclusive?

We have:

[tex]G = \{(W,R),(R,W)\}[/tex]

[tex]H = \{(W,R),(W,W)\}[/tex]

Check for common elements

[tex]n(G\ n\ H) = 1[/tex]

Hence, F and G are not mutually exclusive

please help with the steps thx:)

Answers

Answer:

The answer for the first is $350,325.378, I think

Step-by-step explanation:

I hope this helps, if im wrong im sorry

Answer:

interest: 945,  FV: 6345

FV= 323711.4, Interest: 226211.4

25.21 years

Step-by-step explanation:

question 1:

simple interest formula

PV(1+it)

30 months is equal to 30/12 years or 2.5 (so t= 2.5)

5400(1+.07*2.5)= 6345

This is the future value, to find the interst subtract the present value

6345-5400= 945

2.)

future value of continously compounding interst:

PV(e^(it))

97500*e^(.06*20)= 323711.4

finding the interest is the same as the last one

323711.4-97500=226211.4

3.)

same formula

let x= time in years

[tex]30000=7500e^{.055x}\\4=e^{.055x}\\\ln(4)=.055x\\x=25.20535202[/tex]

i guess we can round this to 25.21

Consider the terms pyramid, line, square, and triangle. The term
is not defined in Euclidean geometry.

Answers

The term line is not defined in Euclidean geometry. ... These words are point, plane and line and are referred to as the "three undefined terms of geometry".

Answer:

LINE is not defined by Euclidian geometry

Step-by-step explanation:

In Euclidean geometry, there are 3 terms that are considered "undefined" they are; point, line and plane.  I think it is because considered undefined because they are described, but not every formally defined.

As in a shape I mean I hope I am right,

What is the common denominator of

Please ignore my choice I had to click one of them

Answers

Answer:

Your choice is correct. GOOD JOB!!

Step-by-step explanation:

Moving to another question will save this response.
1 points
Save Answer
Question 12
Mr Espent 65% of his salary on household expenses, and 15% of the remainder on travelling expenses and was finally left with R9 500. How much was his salary?​

Answers

Answer:

rs.1680.67

Step-by-step explanation:

His salary = x

remaining % = 100 - 65 = 35%

= 100 - 15 = 85%

x × 35/100 × 85/100 = 500

x = 1680.67

Without using a calculator, compute the sine, cosine, and tangent of
330∘ by using the reference angle.

Answers

Answer:

sin(330)=-0.5

cos(330)=0.86

tan(330)=-0.57

HELP ME PLEASE!!!
GIVEN sin0= √23/12
tan0= √23/11
Find cos0

Answers

Answer:

[tex]cos \theta = \frac{11}{12}[/tex]

Step-by-step explanation:

[tex]sin \theta = \frac{\sqrt{23}}{12} \ , \ tan \theta = \frac{\sqrt{23}}{11}\\\\tan \theta = \frac{sin \theta }{cos \theta }\\\\ \frac{\sqrt{23}}{11} = \frac{\frac{\sqrt{23}}{12} }{cos \theta}\\\\cos \theta = \frac{\frac{\sqrt{23}}{12} }{\frac{\sqrt{23}}{11} }\\\\cos \theta = \frac{\sqrt{23}}{12 } \times \frac{11}{\sqrt{23}}\\\\cos \theta = \frac{11}{12}[/tex]

A researcher has obtained the number of hours worked per week during the summer for a sample of 15 students. 40 25 35 30 20 40 30 20 40 10 30 20 10 5 20 Using this data set, compute the following: a. Median b. Mean c. Mode d. 40th percentile e. Range f. Sample variance g. Standard deviation

Answers

Answer:

Mean = 25

Median = 25

Mode = 6

Step-by-step explanation:

Given the data :

Using calculator :

Mode = highest occurring data point

Range = max - min = 40 - 5 = 35

Sample variance = 128.57 (calculator)

Sample standard deviation = sqrt(variance) = 11.34

5. Simplify: 2(4X+3)-(7X+6)
6. Find the perimeter of the metallic sheet
below
n
6
3n
3n
5
7. Write an expression for the sum of on-
sixth of m and one-seventh of n, minus 7
8. Simplify 5-³ x 5⁴ x 2²
9. Find the L.C.M of 2x3², 2x3x7 and 2x3²x5
10. What is the place value of 4 in the number
2043507?
11. Find the G.C.F OF 18,42 and 90​

Answers

Answer:

hshdjdjdjffhdiosekskskdkcjfiririrotr8tti5tittttit4i5i6i6832wy

for f(x)=4x+1 and g(x)=x^2-5, find (f-g) (x) need help guys!

Answers

Answer:

-x^2 +4x +6

Step-by-step explanation:

f(x)=4x+1

g(x)=x^2-5

(f-g)(x) = 4x+1 - (x^2-5)

Distribute the minus sign

           = 4x+1 - x^2 +5

           = -x^2 +4x +6

log (3x+5)=log (2x-7)

Answers

Answer:

x=-12  (BUT IS EXTRENUS)

Step-by-step explanation:

If u dont know what extraneous is, dont worry about it...

Find the volume of the cone

Answers

Volume= 37. 7

V=π r² h/3 = π · 22 · 9/3 ≈37.69911

I hope this helps!

Use the formula below to find the relative pressure inside the can in psi

Answers

Answer:

b

Step-by-step explanation:

you have to have psi to have p-e-n-i-s sand you get a jack hammer

Please someone simplify this and please show the workout

Answers

Step-by-step explanation:

(a) 3pq / 4r² × 2rs / 6q²......first start by expanding the expression

It will be ;

3 × p × q / 4 × r × r X 2 × r × s / 6 × q × q

so now ,cancel out like terms. The q on top can cancel out with the q down same thing happens to r

so you'll get something like ;

3 × q / 4 × r X 2 × s / 6 × q ......so now divide , like 3 into 6 and 2 into 4 ,then you'll get something like;

qs / 4q

that's the answer

(b)15 ab² / 8 c²d ÷ 3ab / 4cd.......start by changing the sign from ÷ to × and then 3ab and 4cd will switch places

15ab² / 8c² d × 4cd / 3ab.....expand the expression

15 ×a×b×b / 8×c×c×d X 4×c×d / 3×a×b

then cancel like terms and you'll get;

15b / 8c X 4/3.....then divide 3 into 15 and 4 into 8

5b / 2c

hope this helps

help pls i'll mark brainliest.. state the length of the line segment shown.

Answers

Answer:

i believe its 3 but i could be wrong

Step-by-step explanation:

sorry if i am..

3 because you can literally count, they even have grids and everything

The Hernandez family is evenly splitting 777 liters of gasoline between their 444 cars.
How many liters of gasoline should each car get?

Answers

Answer:

1.75 liters per car

Step-by-step explanation:

777liters /444 cars=1.75 liters per car

Please help me with this problem

Answers

Answer:

x = 19

Step-by-step explanation:

2x + 3 = 90 - 49

2x + 3 = 41

2x = 38

x = 19

PLS HELP ME!!!! use the properties of exponents to simplify the expression

Answers


Answer: 3

(27^1/2)2/3

So this means you multiply the exponents.

27^2/6

Simplify that 27^1/3

So cubed root of 27 is three.

Answer:

According to Indices

(a⁴)²... The exponents will multiply each other to give (a⁶)

Using this here

The two Index would Multiply to give

½ x ⅔ = ⅓

= (27)⅓

Any Number to the Index of ½ simply means its Square root

so also...

Any Number to the index of ⅓ means its cube root...

Cube root of 27 = 3.

So

Option B is your answer.

Sonia took a loan of $10 000 from ABC bank tob pay for a renovation at home. The bank offered her a period of 30 months at a rate of 10.5%. to repay the loan:

a) Calculate the Simple Interest she would pay in 30 months.

b) Calculate the Total amount Sonia would have to repay the bank.

Answers

Answer:

a. Simple interest, S.I = $2,625

b. Total amount = $12,625

Step-by-step explanation:

Given the following data;

Principal = $10,000

Interest rate = 10.5%

Time = 30 months to years = 2.5 years

a. To find the simple interest;

Mathematically, simple interest is calculated using this formula;

[tex] S.I = \frac {PRT}{100} [/tex]

Where;

S.I is simple interest. P is the principal. R is the interest rate. T is the time.

Substituting into the formula, we have;

[tex] S.I = \frac {10000*10.5*2.5}{100} [/tex]

[tex] S.I = \frac {262500}{100} [/tex]

Simple interest, S.I = $2,625

b. To calculate the total amount Sonia would have to repay the bank;

Total amount = simple interest + principal

Total amount = 2625 + 10000

Total amount = $12,625

Other Questions
Four relatively recent fossil species were recovered, and when the DNA was extracted, investigators observed that Species W and Z both had long finger bones, and species X and Y had short finger bones. Based upon this information and the hypothetical molecular data below, sequenced from common regions in one gene of their DNA, which two species are the most closely related to each other?Species W:AACATTGCTTTTGTAACGAASpecies X:AACCGCGCGTTTGGCGCGCASpecies Y:AGCAGCGCTTTCGTCGCGAASpecies Z:AACCGCGCTTTTGGCGCGAAA) Species X and ZB) Species W and ZC) Species Y and ZD) Species X and Y Our town has ____ museum we could visit Which of the relations below is a function? *2 points{(2, 3), (3, 4), (5, 1), (2, 4)}{(2, 3), (3, 4), (6, 2), (7, 3)}{(2, 3), ( 3, 4), (6, 2), (3, 3)}{(2, 4), ( 3, 4), (6, 3), (3, 3)} PLEASE HELP, WILL GIVE BRAINLIEST FOR RIGHT ANSWER!Indicate the equation of the given line in standard form, writing the answer in the equation box below. The line that contains the point Q (1, -2) and is parallel to the line whose equation is y 4 = 2/3 ( x 3) Activity: write 3 three sentence about the picture. use the correct forms of adjectives in your sentence What type of force are you exerting when you lie on a bed?A. Electric forceB. Magnetic forceC. CompressionD. Tension The first step in the control process is ________. A) setting the desired moralsB) measuring actual performanceC) comparing performance against expectations D) applying managerial control necesito informacin sobre doble toque en voleibol Pls help me answer this :,(What is the equation of the quadratic graph with a focus of (5, 6) and a directrix of y = -12? Does anyone know the answers with big ideas! In Act I, scene ii, Claudiuss mention of Fortinbras raises the issue of _____. the cause of King Hamlets death how Fortinbras is better than Hamlet an external threat to Denmark corruption in Denmarks government Research a modern-day pioneer who became famous for accomplishing something great or moving humanity forward. Someone like Albert Einstein, Orville and Wilbur Wright, or Walt Disney.Analyze and identify how this person maintained a youthful outlook and introduced energy and excitement into their life.Write a short paragraph on one of their great accomplishments, and why they were passionate enough to see it through. Share your short paragraph and a picture of the person on one of your social media pages. What kind of comments did you get from your post? Upload a screenshot of your post here. ng lc qu trnh truyn khi l g? Khi qu trnh truyn khi xyra, ng lc truyn khi xy ra nh th no ? Which best explains whether a triangle with side lengths 2 in., 5 in., and 4 in. is an acute triangle?The triangle is acute because 22 + 52 > 42.The triangle is acute because 2 + 4 > 5.The triangle is not acute because 22 + 42 < 52.The triangle is not acute because 22 < 42 + 52. Based on the short story Phaethon; pretend you are Phaethon in the afterlife, write a letter (at least two paragraphs)to your father telling him how you feel about having asked to ride his chariot.PLEASE NO LINKS!!! The figure below is made of 2 rectangular prisms.What is the volume of this figure? The perimeter of a rectangle is 58 inches and the area is 180 square inches. Find the dimensions of the rectangle. illings and collections between an Enterprise Fund and the General Fund A city uses an Enterprise Fund to provide electricity to its citizens and to its General Fund. A total of $50,000 was billed to the General Fund and collected 30 days later. Prepare the journal entries necessary to record these transactions, and label the fund(s) used. Note: Under the Fund column, select the appropriate fund in which the transaction is recorded (GF: General Fund or ISF: Internal Service Fund). If 5 + 2 root 3 / 7 + 4 root 3 = a - b root 3, find a and b. Read the excerpt from On the Road.In those days he really didn't know what he was talking about; that is to say, he was a young jailkid all hung-up on the wonderful possibilities of becoming a real intellectual, and he liked to talk in the tone and using thewords, but in a jumbled way, that he had heard from "real intellectuals"-although, mind you, he wasn't sonave as that in all other things, and it took him just a few months with Carlo Marx to become completely inthere with all the terms and jargon.Which is a key feature of Kerouac's diction that contributes to his writing style?the use of youth culture slango the use of academic languagethe use of words from other languagesthe use of regional dialects