How would you describe an epithelium consisting of a single layer of cells in which all cells rest directly on the basement membrane and all cells reach the apical surface?.

Answers

Answer 1

Columnar epithelium consists of a single layer of cells in which all cells rest directly on the basement membrane and all cells reach the apical surface.

What is a epithelial tissue?

Epithelial tissue has a free surface, which faces either a body fluid or the outside environment and thus provides a covering or a lining for some parts of the body.

There are two types of epithelial tissues namely :

Simple epithelium: Simple epithelium is composed of a single layer of cells and functions as a lining for body cavities, ducts, and tubes.Compound epithelium: The compound epithelium consists of two or more cell layers and has protective function as it does in our skin.

Simple epithelium is further divided into three types, they are;

The squamous epithelium is made of a single thin layer of flattened cells with irregular boundaries. They are found in the walls of blood vessels and air sacs of lungs and are involved in functions like forming a diffusion boundary.The cuboidal epithelium is composed of a single layer of cube-like cells. This is commonly found in ducts of glands and tubular parts of nephrons in kidneys and its main functions are secretion and absorption.  The columnar epithelium is composed of a single layer of tall and slender cells. Their nuclei are located at the base. Free surface may have microvilli. They are found in the lining of stomach and intestine and help in secretion and absorption.

To learn more about epithelial tissues: https://brainly.com/question/13404204

#SPJ2


Related Questions

What type of material did the water most likely encounter when it stopped?

Answers

Answer:

Rocks

Explanation:

Rocks normally stop streams

What is the correct term for organisms that consume other organisms in order to gain energy and are also known as consumers?
A) Heterotrophs
B) Decomposers
C) Detritivores
D) Autotrophs​

Answers

Answer:

Heterotrophs

Explanation:

A heterotroph is an organism that eats other plants or animals for energy and nutrients.

The correct term for organisms that consume other organisms in order to gain energy and are also known as consumers is Heterotrophs; option A.

What are heterotrophs?

Heterotrophs are organisms which cannot produce their own food but rather depend on other organisms for its food.

Heterotrophs consume other organisms such as plants and other animals for the production of energy.

Therefore, the correct term for organisms that consume other organisms in order to gain energy and are also known as consumers is Heterotrophs; option A.

Learn more about heterotrophs at: https://brainly.com/question/4933024

What are 2 facts about energy?

Answers

Answer: Only 10 percent of energy in a light bulb is used to create light. ...

The amount of energy Americans use doubles every 20 years. ...

Explanation:

Fact 1: Refrigerators in the U.S. consume about the same energy as 25 large power plants produce each year.

Fact 2: From 2008 to 2030, world energy consumption is expected to increase more than 55%.

HELP ASAP WILL GIVE BRAINLISET Which of the following describes the Cell Theory?

Group of answer choices

(A)All

(B)All living things are composed of one or more cells.

©Cells are the basic unit of life

(D)Cells are produced from existing cells

Answers

Answer:

C. Cells are the basic units of life.

Explanation:

Answer: A.) All
Explanation: Wikipedia :/

What is the strengths and weaknesses of the various developments in science and technology​

Answers

Answer:

Strengths, Weaknesses, Opportunities and Challenges ... Some have “ centres for research and development” while others ...

Which gland is known as the "master gland" because it sends chemical messages to many other glands?

Answers

Answer: pituitary gland

Which feature is forming?

Oceanic crust
Continental
crust
Lithosphere
Lithosphere
Asthenosphere

Answers

Answer:

An island

Explanation:

for me i got it right

the carbon cycle review of terms

Answers

Answer:

A solid line would represent point on the graph that actually are included in the solution, while points that lie on dash lines aren't included in the solution.

The carbon cycle takes place in the environment, where plants, herbivores, consumers, and decomposers are present and fix the carbon in the environment.

What is the carbon cycle?

The carbon cycle is important for the environment because carbon is present in the animal cell, in food, etc., and the carbon cycle is present in the given diagram. Here, the plant takes in the atmospheric carbon dioxide shown in the arrow 1, and the carbon dioxide is released by the animals and plants shown in the arrow 2.

Arrow 3 explains the rabbit taking the carbon from the food source, the plant releases oxygen and arrow 4 explains the carbon released by the decomposers from the animals and plants; and arrow 5 shows the carbon converted into fossil fuels. Arrows 6 and 7 both explain the release of carbon dioxide while plants use it for food synthesis.

Hence, the carbon cycle takes place in the atmosphere, where plants, herbivores, consumers, and decomposers are present and fix the carbon in the environment.

Learn more about the carbon cycle here.

https://brainly.com/question/1627609

#SPJ2

The effect of disorder of checkpoints proteins and cell cycle regulation
I need help!!!!!!???

Answers

Answer:

LEARNING OBJECTIVES

Identify important checkpoints in cell division

Explain how errors in cell division are related to cancer

The length of the cell cycle is highly variable, even within the cells of a single organism. In humans, the frequency of cell turnover ranges from a few hours in early embryonic development, to an average of two to five days for epithelial cells, and to an entire human lifetime spent in G0 by specialized cells, such as cortical neurons or cardiac muscle cells. There is also variation in the time that a cell spends in each phase of the cell cycle. When fast-dividing mammalian cells are grown in culture (outside the body under optimal growing conditions), the length of the cycle is about 24 hours. In rapidly dividing human cells with a 24-hour cell cycle, the G1 phase lasts approximately nine hours, the S phase lasts 10 hours, the G2 phase lasts about four and one-half hours, and the M phase lasts approximately one-half hour. In early embryos of fruit flies, the cell cycle is completed in about eight minutes. The timing of events in the cell cycle is controlled by mechanisms that are both internal and external to the cell.

Explanation:

Regulation of the Cell Cycle by External Events

Both the initiation and inhibition of cell division are triggered by events external to the cell when it is about to begin the replication process. An event may be as simple as the death of a nearby cell or as sweeping as the release of growth-promoting hormones, such as human growth hormone (HGH). A lack of HGH can inhibit cell division, resulting in dwarfism, whereas too much HGH can result in gigantism. Crowding of cells can also inhibit cell division. Another factor that can initiate cell division is the size of the cell; as a cell grows, it becomes inefficient due to its decreasing surface-to-volume ratio. The solution to this problem is to divide.

Whatever the source of the message, the cell receives the signal, and a series of events within the cell allows it to proceed into interphase. Moving forward from this initiation point, every parameter required during each cell cycle phase must be met or the cycle cannot progress.

Regulation at Internal Checkpoints

It is essential that the daughter cells produced be exact duplicates of the parent cell. Mistakes in the duplication or distribution of the chromosomes lead to mutations that may be passed forward to every new cell produced from an abnormal cell. To prevent a compromised cell from continuing to divide, there are internal control mechanisms that operate at three main cell cycle checkpoints. A checkpoint is one of several points in the eukaryotic cell cycle at which the progression of a cell to the next stage in the cycle can be halted until conditions are favorable. These checkpoints occur near the end of G1, at the G2/M transition, and during metaphase

plz mark me as brainleast my friend

When you by strawberry is "TEXTURE " matters? and why is that?

Answers

Answer:

Yes, it does.

Explanation:

If the strawberry you buy is all soggy and way too soft, it is likely rotten, while the normal texture we are used to shows that it is edible.

Answer:

Frozen strawberries were characterized organoleptically by a moist, soft and limp appearance, and poor shape retention. They felt very soft, moist, limp and slightly slimy in the mouth. Interior fibers had a tough texture.

Super easy. Please help

Answers

Answer:

Identical twins tend to be more similar to each other than  fraternal twins do.

Explanation:

Put "Allele Frequency" in a sentence

Answers

Answer:

With this data we can built a map of allele frequency and geographic location.

Answer: Here are a variety of sentences you could use...

1. Jensen was born with blue eyes because each of his parents gave him a recessive allele for the trait.

2. The dominant allele is the one that determines a physical characteristic or trait.  

3. Because Jill’s parents both gave her the dominant allele for curly hair, she has a wavy hair texture.

4. Which allele is responsible for blonde hair, the recessive allele or the dominant allele?  

5. On the other hand, the recessive allele is always overshadowed by its dominant partner.  

But this on your own sentences please

Answers

Since hydropower is powered by water, it’s a good fuel source. It will not contaminate the air like power plants that release fossil fuels, for example coal and oil. It does not rely on international fuel sources and lets each state make their own energy.

With respect to normal base pairing, when a molecule of DNA replicates, thymine will most likely pair with 2 points

Answers

Answer: Adenine

Explanation:

The structure of the DNA double helix is complex in nature. There are two strands of DNA that are wound around each other. The nitrogenous bases are bonded with hydrogen bonding and base complementarity. According to the Chargaff's rule of base complementarity adenine always pairs with the thymine and guanine with cytosine. These nitrogenous bases are paired on the basis of hydrogen bonding. Adenine bonded with thymine through two hydrogen bonds whereas the cytosine pairs with guanine via three hydrogen bonds. During DNA denaturation these hydrogen bonds are broken whereas during DNA replication these hydrogen bonds are formed between the nitrogenous bases.

put "Speciation" in a sentence

Answers

Answer:

It flies in the face of currently accepted views of speciation.

Answer:

chromium speciation by different methods of practical use for routine in situ measurement.

Explanation:

describe how acid precipitation affects ecosystems
will give brain crown thingy

Answers

Answer: Acid rain makes such waters more acidic, which results in more aluminum absorption from soil, which is carried into lakes and streams. Trees' leaves and needles are also harmed by acids... They are most clearly seen in aquatic environments, such as streams, lakes, and marshes where it can be harmful to fish and other wildlife.

Explanation: YW <3

Which of the following statements is FALSE?
A. RNA is a single stranded molecule
B. RNA contains uracil
C. RNA is found only in the cytoplasm.
D. RNA contains ribose

Answers

Answer:

C

Explanation:

RNA is found mostly in the nucleus but can also be found in the cytoplasm, but it is not limited to it.

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

A rusty nail is an example of an oxidation-reduction reaction.
A. True
B. False

Answers

Answer:true

Explanation:

Which of the following most accurately describes the National Postsecondary Agricultural Student Organization?
(a)A rival group to FFA.
(b)2.A group similar to FFA but for graduate students.
(c)A group similar to FFA but for college students.
(d)The British version of FFA.

Answers

Answer:

Explanation:

a

Answer:

It's a

Explanation:

WILL GIVE BRAINLIEST!!

A magnetic globe is being held down on a base. When released, the globe rises above the base and eventually comes to rest floating above the base.

In which position shown does the globe have the greatest magnetic potential energy?

Answers

Answer:

Position 1 as the magnetic potential energy is waiting to be released when the hand moves.

Explanation:

Which is an example of a ray-fin fish?
lungfish
O coelacanth
O shark
salmon

Answers

Explanation:

its showing all but salmon so im not sure,sorry, still trying

Answer: Salmon

Explanation:

bones

Put "Evolution of Populations" in a sentence

Answers

Answer:

animals are examples of evolution of population

Explanation:

Which of the following has to
occur in order for mammals to
create offspring?
A. fertilization
B. self-reproduction
C. mutation
D. self-fertilization

Answers

A. Fertilization, would be your answer

A student tries to push a refrigerator-sized box of textbooks safely across the classroom.

The box does not move. He asks for help from other students.

The box starts to move when the number of students shown in the image is pushing together.



Based on this information, what conclusion can be drawn?




The box has a mass greater than the combined mass of the first two students pushing.


The forces acting on the box became unbalanced when the third student started pushing.


The only force acting on the box is the push applied by the students.


When the third student started to push, the box’s mass decreased

Answers

Answer:

The forces acting on the box became unbalanced when the third student started pushing.

Explanation:

The horizontal forces, friction and applied, were balanced until more force was applied than friction. Mass can't increase or decrease.

Answer:

The forces acting on the box became unbalanced when the third student started pushing.

Explanation:

What is the difference between your biological sex and your gender identity?

Answers

Answer:

Biological or assigned sex is about biology, anatomy, and chromosomes and Gender is society's set of expectations, standards, and characteristics about how men and women are supposed to act.

Explanation:

Hope this helps!

biological sex is what gender you were born as and what's on your birth certificate. however, a persons gender identity is a persons own choice. it's what you classify yourself as and what you feel comfortable as, despite your biological sex. many people don't even identify as anything or they change their preference of pronouns. gender identity also comes with stereotypes given by the community and what they see fit for genders.

please help!! i’ll mark brainliest

Answers

Answer:

See if that helps, im pretty sure it increases :)

Explanation:

The rate of photosynthesis does not increase with higher temperatures for all plants. Plants which grow in colder climates have an optimum rate of photosynthesis at low temperatures. Therefore different types of plants have optimum temperatures for photosynthesis.

Material rising from the mantle reaches the surface at spreading centers.
A. True
B. False

Answers

Yes, It's true!

Explanation:

Material rising from the mantle reaches the surface at spreading centers.

A. True

B. False

The total number of cells in an organism increases as a result of which process?
A respiration
B. photosynthesis
C cell division
D fermentation

Answers

Answer:

I am pretty sure that the answer is C.

Hopes this helps.

Have a great day!!!!!!!

It is fermentation... bc it’s the total number

The EPA sets national air-quality standards for common air pollutants. The
data table shows the change in concentrations of these pollutants over time.
Emissions Reductions and Air Quality
Data period
Reduction
Pollutant
Improvement
(from/to)
in emissions (%) in air quality (%)
СО
69
85
Pb
99
98
1980 - 2014 NO,
55
60
0,
53
33
81
80
16
30
2000 - 2014
33
36
SO2
PM,
PM25
Which conclusion do the data support?

Answers

The data support the conclusion that reducing emissions leads to improvement in air quality for the common air pollutants monitored by the EPA.

What is EPA?

The Environmental Protection Agency (EPA) is a federal agency of the United States government that was established in 1970 to protect human health and the environment. The EPA's mission is to ensure that all Americans have clean air to breathe, clean water to drink, and safe land to live and work on. The agency is responsible for setting and enforcing national standards for air and water quality, as well as for managing toxic waste and other pollutants.

The EPA also works with other federal agencies, states, tribes, and local governments to address environmental challenges, such as climate change, ozone depletion, and exposure to hazardous substances. The EPA uses a range of tools and programs, including research and development, regulation, partnerships, and education and outreach, to achieve its mission. The agency also provides information and technical assistance to help individuals, communities, and businesses protect the environment and public health.

Learn more about EPA, here:

https://brainly.com/question/30240841

#SPJ1

Answer:

B . With monitoring, the concentration of every pollutant has decreased

Explanation:

Other Questions
hello anyone can help me thanks! which of the following statements is not characteristic of the schwann cells in wallerian degeneration?A. Schwann cells provide physical guidance needed for the regrowth of the axonB. Schwann cells release trophic factors that stimulate growthC. Schwann cells act to clear the myelin debris with the help of macrophagesD. Schwann cells increase synthesis of myelin lipids in response to axonal damageE. Schwann cells are responsible for myelination of axons in the peripheral nervous system when conducting assessments of the organization's indirect compensation, the assessment should look at all of the following except ________. A. What employees prefer to see the organization doingB. What the organization is doingC. What benefits are the least expensive, regardless of employee preferencesD. What other organizations are doing certain icd-10-cm categories require an extension to provide further specificity about the condition being coded that is referred to as the: shown is a schematic diagram of a membrane phospholipid. which segment will always carry a negative charge? Use the SAS dataset insure to (a) create a new SAS dataset insure10 that i. reads in only Name, Company, PctInsured, and BalanceDue ii. outputs records where Petinsured < 100 iii. only retains the variables Name, Company, and BalanceDue (b) based on the results of the last part, create a listing report which i. is sorted by BalanceDue (largest first) ii. displays Name, Company, BalanceDue iii. uses a dollar format for BalanceDue Repeat Problem 19 for R = 1 mohms, and compare the results.19. For the circuit in Fig. 10.94, composed of standard values: a. Determine the time constant of the circuit. b. Write the mathematical equation for the voltage dC following the closing of the switch. c. Determine the voltage dC after one, three, and five time constants. d. Write the equations for the current iC and the voltage dR. e. Sketch the waveforms for dC and iC. FIG. 10.94 Problems 19 and 20. Cu(s) + 2 Ag+ Cu2+ + 2 Ag(s)If the equilibrium constant for the reaction above is 3.7 x 1015, which of the following correctly describes the standard voltage, E, and the standard free energy change, G, for this reaction?(A) E is positive and G is negative. (B) E is negative and G is positive.(C) E and G are both positive. (D) E and G are both negative.(E) E and G are both zero (15 points) for each of the following problems circle the correct answer. a) how many binary strings of length 5 end with a 0? circle one. i) 4 ii) 8 iii) 16 iv) 23 the view that the country should involve itself deeply in world affairs. cpt code patient was taken to the operating room. She was anesthetized, and the right frontotemporal region was prepped and draped. A burr hole, using a rounded tip, was made into the skull. Immediate evacuation and decompression resulted. the fact that snake phobia is more common than automobile phobia suggests that phobias may result from An equal-tangent crest curve has been designed for 70 mi/h to connect a +2% initial grade and a -1% final grade for a new vehicle that has a 3 ft driver's eye height; the curve was designed to avoid an object that is 1 ft high. Standard practical stopping distance design was used but, unlike current design standards, the vehicle was assumed to make a 0.5g stop, although driver reactions are assumed to be the same as in current highway design standards. If the PVC of the curve is at elevation 848 ft and station 43 + 48, what is the station and elevation of the high point of the curve? More than 8,900,000,000 gallons of water are withdrawn each day from the lakes, rivers, streams, estuaries and ground waters of New York State. The population of New York State is 1. 9 x 107 I have just finished reading A Portrait of a Young Man Drowning by Charles Perry (InternetArchive). There is one sentence I had difficulty in understanding at the end of chapter 25: "I make my way home. It has been asking for a long, long time." What does the last sentence mean? What does "It" refer to? Let me quote the passage preceding to the part in question in case you need it to answer my question. "There is nothing to do but go home. I look desperately around for Madden [the narrator's alter-ego]. What am I doing? There is no Madden. I do what I do. I can no longer deny it. This is reality, sex is real! I do what I must do. Hatred cancels my crime, passion consumes my fears. And I know now what has been the horror of reality for me." I appreciate your help very much. an otherwise valid debt that is barred by a technical defense to enforcement (such as the statute of limitations) will be enforced if the debtor makes a new ____________. Submission link: Report your results by choosing the options presented in the following multiple-choice questionsPart 1. The market D/E ratio, rE and WACC for Home Depot prior to stock and debt repurchases are closest to:[A] 13.9%; 14.1%; 12%[B] 12.5%; 12.8%; 12%[C] 10.9%; 13.0%; 12%[D] 12.9%; 13%; 12.5%Part 1. The rE and WACC increasing debt by $5 billion by reducing equity by 5 billion are clsest to:[A] 13.2%; 12%[B] 12.9%; 13%[C] 13.9%; 14.7%[D] 11.4%; 12.9% Nitrogen oxides are pollutants, and common byproducts of power plants and automobiles. NO2 can react with the NO in smog, forming a bond between the N atoms. Draw the structure of the resulting compound, including formal charges. What techniques provide the only true way to protect your data from access by any other user?A. Regular backupsB. AuthorizationC. EncryptionD. Authentication A contract must be between parties who have _____ to contract. Group of answer choices knowledge capacity resources intention