I am timed on this test so please help! 30 points and will give BRAINLIEST answer! Which graph shows a method for finding the image of point D if the parallelogram is reflected across the dashed line? On a coordinate plane, parallelogram A B C D has points (1, 2), (3, 4), (8, 4), (6, 2). A dashed line goes through points A and C. On a coordinate plane, parallelogram A B C D has points (1, 2), (3, 4), (8, 4), (6, 2). A dashed line goes through points A and C. A red dashed line is drawn from point B to point D. D prime = B. On a coordinate plane, parallelogram A B C D has points (1, 2), (3, 4), (8, 4), (6, 2). A dashed line goes through points A and C. A red dashed line splits the image into 2 equals parts with length of 1.4 centimeters. On a coordinate plane, parallelogram A B C D has points (1, 2), (3, 4), (8, 4), (6, 2). A dashed line goes through points A and C. Point D prime is at (2, 6). On a coordinate plane, parallelogram A B C D has points (1, 2), (3, 4), (8, 4), (6, 2). A dashed line goes through points A and C. A vertical dashed line is drawn through the image.

Answers

Answer 1

Answer:

AAAAAAAAAA

Step-by-step explanation:

me la pela yo tambie quiero tus puntos

Answer 2

Answer:

option B

Step-by-step explanation:

A parallelogram ABCD

To find : Which graph shows a method for finding the image of point D if the parallelogram is reflected across the dashed line?

Since forming the reflected image follows Every point on the image will be the same distance as its corresponding point from the pre-image.  

This distance will be perpendicular to the line of reflection i.e. dashed line  

And the second option shows the correct image .

In the second image the perpendicular was draw along the axis of reflection .

Hence the option B is correct .


Related Questions

The cost of producing an item is $250 at the break-even point. What is the income from selling the same item at the break-even point?

Answers

i would say $250! can i have brainliest answer hehehe
I think the answer would be 250$

121 is 44% of what number?

Answers

^i got that same answer

13 points please help

Answers

90 degrees in a right angle. skipping 12. a supplementary angle is 180 degrees. x is 30. complementary is 90. skip the one you answered. i think the next one is also 157. i’m skipping 16 i keep blanking out. hope i helped a little bit
12. X=20 16. X=19
Explanation: I worked it out

Circle the reason for each of the following manipulations used to simplify the product (8x^2) (3x^7) ?

Answers

Answer:

Running Home and the impact of point of view on events in the poem, “The Sailor.” Use specific examples from BOTH texts to support your answer.

CAN YOU TURN THIS PROMPT INTO A HOW OR WHY QUESTION??

_________________________________________________________

_________________________________________________________

_________________________________________________________

Step-by-step explanation:

Commutative, associative, exponent

Help please ill give brainy (7th grade math)

Answers

Straight line through the origin, hope this helped

Answer:

the answer is straight through the origin

Hailey used 2 2/3 liters of cola to completely fill 2 bottles. If the bottles are all the same size, how many liters of cola does each bottle hold? Enter your answer below

Answers

Answer:

they each hold 1 1/3 litters of cola

Step-by-step explanation:

Because if there is 2 2/3 liters of cola

then you either divide it by 2

or you can look at it and see what would add evenly to make that number

in this case it would be 1 1/3

1 1/3 +1 1/3= 2 2/3

please mark me as brainliest

hope this helps!

Please answer the question attached! Answers would be appreciated :)

Answers

Answer:

60 cm^3 is the volume

Answer:

132 squared cm

Step-by-step explanation:

Alright so assuming the this is a right angle, to find the area of a triangle you have to multiply LxW and divide by 2. 3x4=12/2=6. There are 2 triangles, so 6x2=12

And then to find the area of the rectangle on the bottom, 10x4=40

Next you find the area of the rectangle on the side: 3x10=30

And finally the one that’s slanted on the top: 5x10=50

Add them up and 12+40+30+50= 132

What is the measure of the unknown angle?

Answers

A. 145
EXPLANATION:
There are 2 angles in the picture.
Both angles mist add up to 180
Simply do 180 - 35 = 145.
Have a good day
It’s is 145. Just subtract 180-35.

A groundskeeper needs grass seed to cover a circular field, 290 feet in diameter.
A store sells 50-pound bags of grass seed. one pound of grass seed covers about 400 square feet of field.
What is the size of the field in square feet, to the nearest whole?

Answers

Answer:

66018.5 sq feet  

Step-by-step explanation:

Area =  πr²

To find the Radius R we need Diameter which 290 fee so:

R = Diameter / 2

R = 290/2

R = 145 ft

Now put values in Area Formula

Area = 3.14 x (145)^2

A = 66018.5 sq feet  

Answer these and I will give you Brainliest.
You must answer ALL the questions.

Answers

This is basically doing someone else’s homework

The Barrel in Problems 4 is 5 feet long and the radius of its base is 1.5 feet. ​

Answers

The answer that you are look big for would be 39.829 feet.

Triangles ABC and RST are similar. Find ST.

Answers

Set up;

(15^2)(CB) = (7.5^2)/(ST)

(15^2)/(5) = (7.5^2)/(ST)

Cross-multiply to find ST.

The area of a circle is 64π m². What is the circumference, in meters? Express your answer in terms of \piπ.

PLS PUT ANSWER THATS RIGHT OR A ANSWER THAT SHOWS YOU TRYED

Answers

Answer:  i got c= 28.36m²

Step-by-step explanation:

A=πr2

C=2πr

Solving for C

C=2πA=2·π·64≈28.35926

What is the volume, in cubic centimeters, of a cylinder with a height of 12 centimeters and a base radius of 6 centimeters, to the nearest tenths place?

Please help :(

Answers

Answer:

1357.2

Step-by-step explanation:

volume = r^2 * pi * h

= 6^2 * pi * 12

=432pi

The volume of cylinder is 1357.17 cubic centimeter.

Formula to find the volume of cylinder:

V = base area × height

[tex]V=\pi \times r^{2} \times h[/tex], where r is the radius of circular base and h is the height of the cylinder.

For given example:

a base radius (r) = 6 cm,

a height of a cylinder (h) = 12 cm

Using the formula of volume of a cylinder,

[tex]V=\pi \times 6^{2} \times 12[/tex]

[tex]V=1357.17[/tex] cubic cm

Hence, the volume of a cylinder is 1357.17 cubic centimeter.

Learn more about volume of cylinder:

https://brainly.com/question/24084532

#SPJ2

what is x(X2+3) please help me

Answers

Answer:

x(x²+3)

x³+3x

Step-by-step explanation:

Hope it helps you

I think the answer is 5x

1300 at 11.8% for 2 years

Answers

Answer:At the end of 2 years, your savings will have grown to $1,624.

You will have earned in $324 in interest.

Step-by-step explanation:

Answer:

306.8

Step-by-step explanation:

1300 x .118 = 153.4

153.4 x 2 = 306.8

Hope that helps!

only do the ones i have not done brainlest

Answers

Answer:

I don't understand thia

Answer: 2. y = x times 2.5, 3. y = x - 10, 4. y = x times 6

Step-by-step explanation: I hope that this helps :)

ples i need help asap

Answers

Answer:

Step-by-step explanation:

1. y = 3/2 x - 1

2. y = -2 x + 4

3. y = -3

4. x = 3

5. y = -5/9 x - 1

6. y = -2 x + 7

7. y = 16/5 x - 4

8. y = 8

9. y = -7 x + 5

10. y = -9 x - 2

Answer:

Step-by-step explanation:

Number 1s slope is 1/2, number 2 is -4/3. Number 3 is 0. Number 4 slope is also 0 i think. Number 5-10 im not sure

Find the average rate of change for f(x)=-4x² over the interval -4≤x≤-2. Enter your answer as a number. *

Answers

Answer:

45

Step-by-step explanation:

help me please this is overdue

Answers

Nope this helps :0
I have teaches a photo of how to do this...
Your answer is w7 ft
Look at the guys comments above me

What is the number of terms in this expression?

m/5+4⋅6

Answers

Answer:

I think the answer is two but I could be wrong

there are two terms in the expression

Plz help this is a true or false correct answer only question also giving the points it's worth

1. True or false: the interval used to create the histogram was 4

2 true or false: exactly half of the students that responded to the survey play video games for 10 or more hours​

Answers

Answer:

1.False

the intervals used to create the histogram is 5.5

2.True

more than 10 hours were used by the students in playing the games

The first one is false the second one is true

PLEASE HELP ME WITH MY MATH (1-9)

Answers

1. X= 22
2. X= 57
3.X= 40
4. X= 15
5. X= 15
6. X= 84
7. X= 60
8.X= -26
9. X= 40


(You might want to double check, but I’m pretty sure these are the answers!)

Answer:

x = 14

Step-by-step explanation:

Answering #5 as requested

Sum of interior angles in the triangle is 180°.

Sum of the angles of the given triangle:

(2x + 8) + (5x) + 74 = 180

Solve for x:

2x + 8 + 5x + 74 = 1807x + 82 = 1807x = 98x = 14

aloha! Makemake au i kōkua me kēia nīnau: Inā he ʻumi mau ʻāpala ʻo jimmy a ʻai kāna hoa i 15 mau ʻāpala he aha ka mea e waiho ai iā jimmy?

Answers

Answer: -5

Step-by-step explanation: unless she ate her own apples the he still has 10

A dolphin is underwater. Its position below sea level changes by -42.5 ft in 5 minutes. What is the average change in the dolphin's position each minute?

Answers

Answer: -8.5

Step-by-step explanation: To find the rate, do 42.5 /5 and you get 8.5 but don’t forget since your going down it’s negative.

Which BEST describes the shape of the distribution
Options

a:uniform
b: skewed right
c: skewed left
d: roughly symmetrical

Answers

Answer:

b

Step-by-step explanation:

B because it goes to the right and go up

Shane has a piece of rope that is 7 4/5 units long. If he cuts it into pieces that are each 3/5 of a unit long, how many pieces does he have?

Answers

Answer:

13 pieces

Step-by-step explanation:

7 4/5 divided by 3/5 is equal to 13

Number of pieces = (7 4/5) / (3/5) = (39/5) / (3/5) = (39/5) x (5/3) = 13 pieces

Help, please I really want to get a good grade

Answers

Answer:

this is khanacadamy it doesn't count!

Step-by-step explanation:

Hiroki's goal is to collect $40 for a school fundraiser. He already collected $26.50. Hiroki wants to know how much more money he needs to collect.
Let m be the amount of money Hiroki still needs to collect. Describe the situation with an equation.

Answers

40-26.50= 13.50
You subtract 26.50 from 40 which will give 13.50

Hiroki needs to collect $13.50 more.

What is Algebra?

Algebra, a discipline of mathematics where abstract symbols rather than concrete numbers are subjected to arithmetic operations and formal transformations. The idea that there is such a separate branch of mathematics, as well as the term algebra to identify it, came about gradually through time. It tries to find solutions to equations that contain one or more unknown quantities. Although early mathematicians would not have been familiar with such a concept, the word "equation" is frequently employed to conveniently represent these operations when discussing the early history of algebra.

As per the given data:

Total amount to be collected = $40

Amount already collected = $26.50

To find the amount of money still to be collected (m):

Total amount to be collected - Amount already collected

= $40 - $26.50

= $13.50

Hence, Hiroki needs to collect $13.50 more.

To learn more about Algebra, click:

brainly.com/question/24875240

#SPJ3

Please help I do not understand pleasee brainliest!

Answers

For answer 3 you take -4 you put it on -4 on the graph -6 you put it on -6 on the graph 0 you put it on 0 on the graph 3 you put it on 3 on the graph
Other Questions
what's the fourth proportional of 0.2, 0.5, 6 transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid- What is the best name for polynomial with 3 terms that has a degree PLEASE HELP ITS DONE IN 16 HOURSSS!!!question: A substance with 12 negatively charged atoms combined with a substance that has 10 positively charge atoms. What is the total charge of the substance when the atoms are combined?answer options: +22-22+2-2 6. What were the first Native American civilizations, and where were they located? Estoy tan aburrida as que aqu hay algunos puntos gratis. What percentage of Americans use solar power ? Copy the shape and fill in the missing angle. Sow the work. Thanks. hey can someone give me an idea how I should do a rough draft on a computer What is the range of the function y=-2/3x-10given a domain of{-9,-3,0,3,9} Read this sentence from paragraph 2 of "Puzzle Solved"Solving this thing is as easy asslaying Medusa!Why does Anya compare the cryptogram to slaying Medusa?A It is difficult to conquerOB. It is based on mythologyoc. It is not what it seems.OD. It is hard to look at. A 55 kg boy is riding a skateboard at a speed of 1.0 m/s. What is hiskinetic energy? A right rectangular prism has a length of 6 centimeters, a width of 7 centimeters, and a height of 5 centimeters. What is the volume of the prism? ____cm3a) 214b) 197c) 210CORRECT ANSWER= BRAINLY!! 60>x and x >57A x=61B x=59C x=50 In a transverse wave, the distance from any two consecutive crest or any two consecutive troughs is called the How will the motion of an object be affected if equal forces are applied in opposite directions? Pls, answer asap!When two objects of different temperatures are placed in contact with one another, eventually: (choose one option from below)a) both their average kinetic energy and temperature will be the sameb) their average kinetic energy will be the samec) neither their average kinetic energy and temperature will be the samed) their temperature will be the same 1 NEED HELP ASAP WILL GIVE BRAINLY Help please please help me Line r is parallel to line c.