I will give you brainliest whoever answers correct first !!

I Will Give You Brainliest Whoever Answers Correct First !!

Answers

Answer 1

Answer:

34.4

Step-by-step explanation:

(54/11) --> ratio of one side of the larger triangle to the smaller one multiplied by 7 = 34.36363636... Rounding it to the nearest tenth is 34.4


Related Questions

Tina's bakery, sells cinnamon, banana, apple and blueberry muffins. Each day the bakery bakes 63 apple muffins, the apple muffins represent 42℅ of all the muffins baked each day, how many muffins are baked each day.

Answers

Ok. So if 42 % is apple, then 63 = 42%.

You can divide it by 42 to get 1%

63 / 42 = 1.5

Than times by 100 to get 100%

100% = 150.

150 Muffins per day

An investor has an account with stock from two different companies. Last year, her stock in Company A was worth $1300 and her stock in Company B was worth $4820. The stock in Company A has decreased 22% since last year and the stock in Company B has decreased 25%. What was the total percentage decrease in the investor's stock account? Round your answer to the nearest tenth (if necessary).

Answers

The answer is 6073 !

Answer:

24.4%

Step-by-step explanation:

A news report states that the 99% confidence interval for the mean number of daily calories consumed by participants in a medical study is (1850, 2000). Assume the population distribution for daily calories consumed is normally distributed and that the confidence interval was based on a simple random sample of 18 observations. Calculate the sample mean, the margin of error, and the sample standard deviation based on the stated confidence interval and the given sample size. Use the t distribution in any calculations and round non-integer results to 4 decimal places.

Answers

Answer:

The sample mean is of 1925 calories.

The margin of error is of 75 calories.

The sample standard deviation is of 109.7992 calories.

Step-by-step explanation:

Sample mean:

The sample mean is the mean value of the two bounds of the confidence interval. So

[tex]M = \frac{1850 + 2000}{2} = 1925[/tex]

The sample mean is of 1925 calories.

The margin of error

Difference between the bounds and the sample mean. So

2000 - 1925 = 1925 - 1850 = 75 calories.

The margin of error is of 75 calories.

Sample standard deviation:

Here, I am going to expand on the t-distribution.

The first step to solve this problem is finding how many degrees of freedom, we have. This is the sample size subtracted by 1. So

df = 18 - 1 = 17

99% confidence interval

Now, we have to find a value of T, which is found looking at the t table, with 17 degrees of freedom(y-axis) and a confidence level of [tex]1 - \frac{1 - 0.99}{2} = 0.995[/tex]. So we have T = 2.898

The margin of error is:

[tex]M = T\frac{s}{\sqrt{n}}[/tex]

In which s is the standard deviation of the sample and n is the size of the sample.

Since [tex]M = 75, T = 2.898, n = 18[/tex]

[tex]M = T\frac{s}{\sqrt{n}}[/tex]

[tex]75 = 2.898\frac{s}{\sqrt{18}}[/tex]

[tex]s = \frac{75\sqrt{18}}{2.898}[/tex]

[tex]s = 109.7992[/tex]

The sample standard deviation is of 109.7992 calories.

PLEASE HELP !! ILL GIVE BRAINLIEST *EXTRA 40 POINTS* DONT SKIP :(( .!

Answers

Answer:

B) one solution

Step-by-step explanation:

to understand thisyou need to know about:linear equationPEMDAStips and formulas:[tex]\sf\text{a system of linear equation has only one solution if $\frac{a_1}{a_2}\neq \frac{b_1}{b_2}$}[/tex]given:[tex] \begin{cases}2x - 4y = - 1 \\ 8x - 11y = - 19 \end{cases}[/tex]let's solve:

[tex] \sf substitute \: the \: value \: of \: a \: b : \\ \frac{2}{8} \ne \frac{ - 4}{ - 11} \\ [/tex]

[tex]\text{$\therefore$ the system of linear equation has only one solution}[/tex]

5x + 4 = 3x + 10 how would you solve for the value of x? How would you prove your solution is correct? How would you prove another value is incorrect? Explain in as much detail as possible.

Answers

5x+3=3x+10 the first thing we're going to do it to subtract 3 from both sides which would look like this

5x+3-3x=10 (the minus because it changed place)

from 5x and 3x we get 2x so the next step is 2x=10-3 which is 7

so now we have

2x=7

x=7/2

Answer:

x=3

Step-by-step explanation:

5x+4 = 3x+10

2x = 6

therefore, x = 3

Verification:

5 * 3 + 4 = 3 * 3 + 10

15+4 = 9+10

19=19

Therefore, LHS= RHS

Hence Proved!

Drag each tile to the correct box. Ross has a box of movies in four genres: romance, comedy, drama, and science fiction. The table gives the probability of picking a movie of each genre. Movie Genre Probability romance 0.38 comedy 0.1 science fiction 0.22 drama 0.3 As part of an experiment, Ross picks a movie at random and then replaces it. He repeats the process 200 times. Place the following events in order from the event with the lowest predicted frequency to the event with the highest predicted frequency. picking a romantic movie picking a comedy movie picking a science fiction movie picking a dramatic movie , , ,

Answers

Answer:

0.1

0.3

0.22

0.38

Step-by-step explanation:

Answer:

1ST BOX Picking a Comedy movie

2ND BOX picking a science  fiction movie

3RD BOX picking a dramatic movie

LAST BOX Picking a romantic movie

Step-by-step explanation:

I took the test

pls answer i have a ton of homework

Answers

Answer:

ewqvrdvfgbt2nbvcx

Step-by-step explanation:

Answer:

the answer is 9

Step-by-step explanation:

Answer this correctly I’ll give brainalist + 10 points

Answers

The Answer is 66

That small little box there that’s 90

You subtract 90 with 24 and you should get 66
The answer to your asked question is 66, 90-24=66. Hope this helped have a good day/night!

There are blue, red and yellow counters in a bag in the ratio 3:2:1. There are 6 more blue counters than red counters. How many counters are there in total?

Answers

Answer:

12

Step-by-step explanation:

im pretty sure its 12 if not im sorry

Three different methods for assembling a product were proposed by an industrial engineer. To investigate the number of units assembled correctly with each method, 30 employees were randomly selected and randomly assigned to the three proposed methods in such a way that each method was used by 10 workers. The number of units assembled correctly was recorded, and the analysis of variance procedure was applied to the resulting data set. The following results were obtained: SST = 10,800; SSTR = 4560.
Set up the ANOVA table for this problem (to 2 decimals, if necessary).
Source of Variation Sum of Squares Degrees of Freedom Mean Square F
Treatments
Error
Total
Use {Exercise 13.07} Three different methods for assem = .05 to test for any significant difference in the means for the three assembly methods.
Calculate the value of the test statistic (to 2 decimals).
The p-value is Selectless than .01between .01 and .025between .025 and .05between .05 and .10greater than .10Item 11
What is your conclusion?
SelectConclude not all means of the three assembly methods are equalCannot reject the assumption that the means of all three assembly methods are equal
Item 12are my calculations correct?

Answers

Given :

Number of methods, k = 3

Number of the observations, n = 30

Degrees of freedom Treatment = k - 1

                                                     = 3 - 1 = 2

Degrees of freedom for error = n - k

                                                 = 30 - 3 = 27

[tex]$SSTR = 4560, \ SST = 10800$[/tex]

[tex]$SSE = SST - SSTR$[/tex]

       = 10800 - 4560

       = 6240

[tex]$SSE_{treatment} = MS_{treatment } \times DF_{treatment}$[/tex]

[tex]$MS_{treatment} = \frac{4560}{2}=2280$[/tex]

[tex]$MS_{error}=\frac{SSE_{error}}{DF_{error}}$[/tex]

             [tex]$=\frac{6240}{27}=231.1$[/tex]

[tex]$F=\frac{MS_{treatment}}{MS_{error}}$[/tex]

  [tex]$=\frac{2280}{231.1}=9.865$[/tex]

Source variation   Sum of square  Degrees of freedom  Mean square     F

Treatment                   4560                          2                         2280       9.8653

Error                            6240                         27                   231.11111111

Total                            10800

The critical value of F for the 0.05 sig level and df (227) is 3.354

Since the test stat > critical value of F, so we reject null hypothesis and state that there is a significant difference in the means of the three assembly methods.

The average daily balance of a credit card for the month of November was $700, and the unpaid balance at the end of the month was $1,400. If the monthly interest rate is 1.3% of the average daily balance, what is the total balance on the next billing date December 1? Round your answer to the nearest cent.

Answers

Answer:

This answer is on quizlet

Step-by-step explanation:

Answer:3255.20

Step-by-step explanation:

First, calculate the interest using the APR in decimal form (divided by 12) and the average daily balance.

Interest =0.27612×$2,400=$55.20

Then add the interest to the unpaid balance.

Total Balance =$3,200+$55.20=$3,255.20

A roll of quarters has a value of
$10. The expression
10 represents the amount of money in a number of rolls of quarters. What does the variable

represent?

Answers

Answer:

110

Step-by-step explanation:

Help plz....................

Answers

Answer:

x = 136°

y = 44°

Step-by-step explanation:

x + 44° = 180° (Adjacent angles of a parallelogram)

x = 180° - 44°

x = 136°

y = 44° (Opposite angles of a parallelogram)

3x = 20

What are the angle measures

Answers

Answer:

equation: 3x - 20 = 0

Step-by-step explanation:

3x = 20

add its opposite to both sides.

3x - 20 = 20 - 20

= 3x - 20 = 0

Helppppppppppppppppppppp

Answers

C hope that helps because if you look at your answers and compare your question to that there u go

Find each product mentally, using the distributive property, 4x51/8. (giving brainliest)

Answers

Answer:

25.5

Step-by-step explanation:

4 x 51 / 8

204/8

25.5

Answer:

Step-by-step explanation:

4×15/8 = 4×(1+⅞) = 4×1 + 4×⅞ = 4 + 7/2 = 4 + 3.5 = 7.5

help do not scam me ok I will give 40 points

Answers

Answer:

C. Preform calculations on my own and compare them to Roberto’s.

Step-by-step explanation:

His calculations do not match the line plot. He doesn’t account for every mark on the plot.

At an Auto Repair shop, 4 of the 16 cars received oil changes. What percent of the cars received oil changes?

Answers

Answer:

its 25 percent

Step-by-step explanation:

want an explanation cuz im happy to give you 1

in the following figure, the value of x is ____

Answers

Answer:

it should be 20 i hope it helps but im nt 100% sure

Step-by-step explanation:

Rashads teacher buys paperback books for her classroom library. Each book costs $6, and she spends a total of $150. Which equation models the number of books, n, she buys? A. 6n=150 B. n/6=150 C.150-n=6 D. 6•150=n

Answers

Answer:

A  

Step-by-step explanation:

6n=150

270 because yea hahahahaha

Type the answer in the box.

d = 6 y = 10 g = 8

Answers

Step-by-step explanation:

[tex](6) + \frac{1}{2} (10 + 8)[/tex]

[tex]6 + \frac{1}{2} (18)[/tex]

[tex]6 + \frac{18}{2} [/tex]

[tex]6 + 9[/tex]

[tex]15[/tex]

Answer:

15

Step-by-step explanation:

can somebody help me?

Answers

Answer:

15x + 7

Step-by-step explanation:

i set this up

8x + 16 + 7x -9

the next step is to combine like terms

8x + 7x = 15x

16 - 9 = 7

15x = 7

15x + 7

the answer is going to be 15x + 7

. 16 is 20% of what number? Show your work and/or explain your reasoning.

Answers

Answer:

0.8

Step-by-step explanation:

.16/.2 = 0.8

check

0.8 x .2 = 0.16

Lainey brought a set of 22 markers for $6. What is the cost of 1 marker? Round answers to the nearest hundredths where necessary.

Answers

The answer It’s about .360

When a famous artist was just beginning her career, she sold a painting for $250. Her artwork has been increasing in value by 15% every year as her popularity has grown. If this rate continues, how much will the painting be worth in 10 years? Round your answer to the hundredths place if needed.

Answers

Answer:625 dollars

Step-by-step explanation:

I will mark someone brainliest!

Answers

Answer:

2nd option is the correct answer

Step-by-step explanation:

Oscillating powerful magnets within wire coils.

Answer:

Step-by-step explanation:

I think it's got to be coal because the power plants always have like smoke and d is the only one that burns something

An elementary school is offering 3 language classes: one in Spanish, one inFrench, and one in German. The classes are open to any of the 100 students inthe school. There are 28 students in the Spanish class, 26 in the French class,and 16 in the German class. There are 12 students that are in both Spanish andFrench, 4 that are in both Spanish and German, and 6 that are in both Frenchand German. In addition, there are 2 students taking all 3 classes.(a) If a student is chosen randomly, what is the probability that he or she isnot in any of the language classes

Answers

Answer:

0.5 = 50% probability that he or she is not in any of the language classes.

Step-by-step explanation:

We treat the number of students in each class as Venn sets.

I am going to say that:

Set A: Spanish class

Set B: French class

Set C: German class

We start building these sets from the intersection of the three.

In addition, there are 2 students taking all 3 classes.

This means that:

[tex](A \cap B \cap C) = 2[/tex]

6 that are in both French and German

This means that:

[tex](B \cap C) + (A \cap B \cap C) = 6[/tex]

So

[tex](B \cap C) = 4[/tex]

4 French and German, but not Spanish.

4 that are in both Spanish and German

This means that:

[tex](A \cap C) + (A \cap B \cap C) = 4[/tex]

So

[tex](A \cap C) = 2[/tex]

2 Spanish and German, but not French

12 students that are in both Spanish and French

This means that:

[tex](A \cap B) + (A \cap B \cap C) = 12[/tex]

So

[tex](A \cap B) = 10[/tex]

10 Spanish and French, but not German

16 in the German class.

This means that:

[tex](C - B - A) + (A \cap C) + (B \cap C) + (A \cap B \cap C) = 16[/tex]

[tex](C - B - A) + 2 + 4 + 2 = 16[/tex]

[tex](C - B - A) = 8[/tex]

8 in only German.

26 in the French class

[tex](B - C - A) + (A \cap B) + (B \cap C) + (A \cap B \cap C) = 26[/tex]

[tex](B - C - A) + 10 + 4 + 2 = 26[/tex]

[tex](B - C - A) = 10[/tex]

10 only French

28 students in the Spanish class

[tex](A - B - C) + (A \cap B) + (A \cap C) + (A \cap B \cap C) = 16[/tex]

[tex](A - B - C) + 10 + 2 + 2 = 28[/tex]

[tex](A - B - C) = 14[/tex]

14 only Spanish

At least one of them:

The sum of all the above values. So

[tex](A \cup B \cup B) = 14 + 10 + 8 + 10 + 2 + 4 + 2 = 50[/tex]

None of them:

100 total students, so:

[tex]100 - (A \cup B \cup B) = 100 - 50 = 50[/tex]

(a) If a student is chosen randomly, what is the probability that he or she is not in any of the language classes?

50 out of 100. So

50/100 = 0.5 = 50% probability that he or she is not in any of the language classes.

what are prime factors

Answers

Answer:

Prime Factors is a  factor of a given integer which is also a prime number.

numbers like 9, 13, 7 and etc

LAST QUESTION I NEED! Should be easy (I don’t think the answer is 4 might be wrong if given an explanation)

Answers

Answer:

2

Step-by-step explanation:

because 2 square is 4 then that was needed for the other squares but this one is doubled

2 1/4 divided by 6
PLS I NEED HELP ASAP

Answers

Answer:

.375 which is 3/8

Step-by-step explanation: If you meant the mixed fraction 2 1/4 divided by 6 then that is the answer! 2 1/4 =2.25 and divide it by 6 and you get 0.375

Answer:

3/8

Step-by-step explanation:

convert mixed numbers to improper fractions

21/4 = 9/4

convert element to fraction

6=6/1

9/4 divided by 6/1

apply the fraction rule (hope you're familiar)

9/4 * 1/6

cross- cancel common factor 3

3*1 = 3

4*2 = 8

multiply the numbers

3/ 4*2

3/8

Other Questions
Fill in the blank in the following sentence with "en" or "Y"as appropriate.J___ vais.yen b(1)= -12b(n)=b(n1)4Find the 3rd term of the sequence. Show me the solutions and calculations. un debate sobre temas controversiales como lalegalizacin de las drogas, la homosexualidad, la eutanasia y lamigracin. Toma en cuenta estructura. 7. Find the inverse of f(x) = -2x + 10. Please show work. Which is NOT a type of crowd?ConventionalO FormativeO CasualO Expressive A slide at a children's park is 74 inches tall in the horizontal distance The slide covers is 70 inches what is the angle measures created by the slide and the ground a cyclist covers a distance of 15km in 2hours calculate his speed Who suspects Macbeth of foul play? 6.The bolded words are " I long to hear you", and " I long to hear you".Read the following passage from Shenandoah. Which sound device is expressed by the bolded words?Shenandoah, I long to hear you,Away, you rolling river,Oh, Shenandoah, I long to hear you,Away, I'm bound away,'Cross the wide Missouri.A. refrainB. repetitionC. alliterationD. rhyme Civil rights in the United States are meant to make sure that: A. all races are treated equally. B. states can segregate services. C. the courts don't have too much power. D. schools get enough money to operate.I will give brainliest. Question 1 ( point) A 64g sample of Germanium-66 is left undisturbed for 12.5 hours. At the end of that period, only 2.0g remain. How many half-lives transpired during this time period? half-lives Answer = Blank 1: The sum of a number and six times its reciprocal is 10. Find the number If this work is a throne for the greatest rapper, who should occupy it? Make a case. What is the meaning of the term metabolism? The term "para" in Paralympics means? Use the points in each diagram to name the figure shown what is - 5 = -2 what is the questionwhat is the question Solve for x. Enter the solutions from least to greatest. (5x+4)(x3)=0lesser x= greater x= what's the fourth proportional of 0.2, 0.5, 6 transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-