The sequence of the Crick strand can be determined by using the complementary base pairing rules of DNA. The Watson strand is read in the 5' to 3' direction, so the complementary Crick strand will be read in the 3' to 5' direction.
The complementary base pairs are:
- Adenine (A) pairs with Thymine (T)
- Guanine (G) pairs with Cytosine (C)
Starting from the 3' end of the Watson strand, we can write the sequence of the Crick strand:
3’ TACCATGTACCCAGGTTACGT 5’
Therefore, the sequence of the Crick strand is 3’ TACCATGTACCCAGGTTACGT 5’.
Hi! To find the sequence of the Crick strand for a double-stranded DNA with a given Watson strand of 5' ATGGTCATGGGTTCCAATGCA 3', you need to understand the base pairing rules for DNA. In DNA, adenine (A) pairs with thymine (T) and guanine (G) pairs with cytosine (C).
Your Watson strand: 5' ATGGTCATGGGTTCCAATGCA 3'
Step 1: Determine the complementary base pairs for each base in the Watson strand.
A pairs with T
T pairs with A
G pairs with C
C pairs with G
Step 2: Replace each base in the Watson strand with its complementary base pair.
TACCATGTCCCAAGGTTACGT
Step 3: Write the Crick strand in the 5' to 3' direction.
5' TACCATGTCCCAAGGTTACGT 3'
The sequence of the Crick strand for the given double-stranded DNA is 5' TACCATGTCCCAAGGTTACGT 3'.
The Crick strand for the given Watson strand (5' ATGGTCATGGGTTCCAATGCA 3') can be determined by using complementary base pairing rules. The Crick strand sequence is: 3' TACCAGTACCCAAAGGTTACG 5'
The Watson and Crick strands of double stranded DNA run antiparallel to each other, meaning that they run in opposite directions. The Watson strand runs from 5' to 3' and the Crick strand runs from 3' to 5'. Therefore, to determine the sequence of the Crick strand, we need to first reverse the direction of the Watson strand.
The reverse of the Watson strand would be 3' TACCGTACCCCAAGGTTACGT 5'. To determine the sequence of the Crick strand, we need to find the complementary base pairs for each nucleotide on the reverse of the Watson strand. Adenine (A) pairs with thymine (T) and guanine (G) pairs with cytosine (C). Therefore, the sequence of the Crick strand would be:
3' TACCGTACCCCAAGGTTACGT 5' (reverse of Watson strand)
|||||||||||||||||||
5' ATGCAGTACCCAGGTTACGTA 3' (Crick strand)
To know more about strand visit :-
https://brainly.com/question/30641440
#SPJ11
Can someone help with this ?
Answer:
to convert ADP to ATP
= first option
Explanation:
so it must be the first option
since in order for this conversion the process stated in the first option must occur.
Necesito hacer un mapa mental sobre taxonomia y fuandamento filosofico como lo puedo hacer me ayudan plis es urgente
Answer:
A taxonomy map of philosophy is created using 5 layer version
Explanation:
The map is drawn in a circular form, the parent is usually the center and then the child or the sub branches are then made around the first- parent circle to show the relation between the parent and its child. These branches can have their own sub branches which are then included around the branches the child of the original parent.
What would happen to the production of the high energy sugars if water or carbon dioxide were not
available to plants?
ATD
Answer:
There would be no production of high energy sugars in the plant.
Explanation:
Plants produce their food (autotrophism) in a process unique to them called PHOTOSYNTHESIS. Photosynthesis is the process whereby plants produce energy-storing sugars (glucose) in the presence of light from sun.
This photosynthetic process combines Carbon dioxide (CO2) and water (H2O) as reactants to form sugar (C6H12O6) and oxygen (O2) as products. The equation for photosynthesis is as follows:
6CO2 + 6H2O → C6H12O6 + 6O2
This means that water and carbon dioxide are strictly needed for the process of photosynthesis to occur in plants. Hence, if water or carbon dioxide were not available to plants, there would be no photosynthetic process and ultimately no production of high energy sugars.
How many valence electrons does this atom have? How do you know?
Answer:
5 valence electrons
Explanation:
valence electrons are the electrons at the ends of atom or in the valence cell. so there are 5 valence electrons.
7._________________________ lines your digestive tract and blood vessels. It moves food and blood through your body.
smooth muscle
skeletal muscle
cardiac muscle
Answer:
Smooth Muscle
Explanation:
In the digestive tract it's called the muscularis mucosa.
What is the name of the site of transcription?
1. Amino acid
2. Nucleus
3. Cytoplasm
4. Mitochondria
Precautions to take during potato osmosis lab
Describe the two signals and pathways that are activated when you touch something and experience pain
HELPP
The diagram below shows the similarities and differences of plants and animals complete the diagram by filling in the correct term as follows: heterotrophic and autotrophic and multicellular
Answer:
Both are multicellular (plants have different cells for the leaves and the stem, animals have skin cells, brain cells etc so they are called multicellular).
Plants are autotrophic - they make their own food (glucose) by photosynthesis
Animals are heterotrophic - they eat other organisms, cannot make their own food.
Explanation:
While exploring a rock formation, Hiroto finds a rock that has footprints pressed into it. A geologist tells Hiroto that the rock is millions of years old. Which of these claims
is correct about Hiroto's find?
It is not a fossil because footprints are not fossils.
It is not a fossil because only whole organisms are fossils.
It is a fossil only if Hiroto finds actual parts of the organism in rocks nearby.
It is a fossil because footprints of organisms from million of years ago are considered to
be fosss
Answer:
5 is the answer
Explanation:
Answer:
message me on ig
Explanation:
she.hatezay ill help you there
What happens during translation?
a. Messenger RNA is made from a DNA code.
b. The cell uses a messenger RNA code to
make proteins.
c. Transfer RNA is made from a messenger
RNA code.
d. Copies of DNA molecules are made.
2. Which atom in the water molecule is negatively charged?
Answer:
oxygen atom
Explanation:
The unequal sharing of electrons gives the water molecule a slight negative charge near its oxygen atom and a slight positive charge near its hydrogen atoms. When a neutral molecule has a positive area at one end and a negative area at the other, it is a polar molecule.
Answer:
The oxygen
Hydrogen is positive
Explanation:
differentiate between thallophyta bryophyta and tracheophyta
Answer:
The main difference between Thallophyta Bryophyta and Pteridophyta is the organization of each phylum. Thallphyta consists of algae, fungi, lichens, and cyanobacteria. The plant body of Thallophyta is a thallus. ... The plant body of bryophytes is not differentiated into true stem, roots, and leaves.
Explanation:
Your body uses feedback mechanisms to help maintain a stable internal environment called homeostasis. Changes can come from outside or inside the body and the body must respond to these adverse changes to return to a steady state. One such example is what happens when you go for a run on a hot summer day and your body temperature increases. According to the diagram, one of the mechanisms used to cool down is vasodilation. Similar mechanisms are also used when your body temperature drops due to a cold environment. Which of these would NOT help return a body to homeostasis by increasing body temperature?
A) shivering
B) vasoconstriction
C) muscles contract
D) increasing blood pressure
Answer:
Option D increasing blood pressure.
Explanation:
Increasing blood pressure
What is feedback mechanism in homeostasis?
Homeostasis is generally maintained by a negative feedback loop that includes a stimulus , sensor , control center , and effector . Negative feedback serves to reduce an excessive response and to keep a variable within the normal range.
What are the two feedback mechanisms which work to maintain homeostasis?
Homeostasis typically involves negative feedback loops that counteract changes of various properties from their target values, known as set points. In contrast to negative feedback loops, positive feedback loops amplify their initiating stimuli, in other words, they move the system away from its starting state.
To learn more about homeostasis here
https://brainly.com/question/3888340
#SPJ2
What effect does the deer's behavior have on the survival and reproduction of these two
types of cactus?
PLS HELP
Answer:
Greatly affected.
Explanation:
The deer's behavior has greatly affected the survival and reproduction of these two types of cactus because one cactus is eaten by deer while the other is saved from it. The cactus with no spines are eaten by deer which destroy the vegetative as well as reproductive parts of cactus so its survival and reproduction does not occur whereas the other cactus have spines on its body is save from deer and increase in the chances of survival and reproduction occur.
How is the brain involved with the senses and what is the relationship to the wat a personreacts to objects?
Answer:
The senses are the components of our nervous system that capture stimuli from the environment for transmission to the brain, and it is there where the information is processed to issue a response. All sensations are electrical signals that travel through neurons which form a network that communicates all organs with the center of the nervous system, and communicate with each other to transmit the electrical impulse through a process known as synapsis.
Explanation:
The brain is an organ that controls the activity of the body, both its conscious and unconscious functions. It is located in the head and corresponds, therefore, to the encephalon of humans and other vertebrates and is subdivided into forebrain, midbrain and hindbrain.
The brain acts on the rest of the organism by generating muscle activity or by the production and secretion of chemicals called hormones. Thereby the brain controls responses to changes in the environment. Some basic types of response such as reflexes may be mediated by the spinal cord or peripheral ganglia, but sophisticated intentional control of behavior based on complex sensory information requires the integration of information.
The thalamus, which is located in the central part of the brain, processes and coordinates the messages from the senses that it receives from the body. Five senses are considered to exist: sight, touch, smell, taste and hearing. For that, the information perceived from the outside must reach the brain.
The senses are the components of our nervous system that capture stimuli from the environment for transmission to the brain, and it is there where the information is processed to issue a response. Therefore, all sensations perceived from the outside are electrical signals that travel through neurons. For example, the eyes transform light signals into electrical impulses, which travel to the brain where they are transformed into electrical signals.
Neurons form a network that communicates all organs with the center of the nervous system, and communicate with each other to transmit the electrical impulse through a process known as synapsis, which is mediated by molecules called neurotransmitters. Since the electrical impulse cannot jump directly from one neuron to another, these neurotransmitters are needed. When the active neuron produces them, the next neuron in the network detects them and becomes electrically charged. Once this has happened, it produces neurotransmitters again so that the next one becomes electrically activated. This is how the electrical impulse reaches the brain.
During the process of photosynthesis, green plants produce...
(1) sunlight
(3) nitrogen
(2) methane
(4) sugar
Answer:
4
Explanation:
Plants are autotrophs, which means they produce their own food. They use the process of photosynthesis to transform water, sunlight, and carbon dioxide into oxygen, and simple sugars that the plant uses as fuel
What does semiconservative replication refer to?
a
Both strands are new in each new DNA molecule.
Both strands are conserved in each new DNA
molecule.
с
One strand is conserved and one strand is new in
each new DNA molecule.
d none of the above
Answer:
it is a
Explanation:
Both strands are new in each new DNA molecule.
Lack of medical knowledge
I NEED HELP! Complete the table of the following element. Element: Chlorine Symbol: Cl
number of Protons:
Neutrons:
Electrons:
Atomic Number:
Atomic Mass:
Answer:
For example, the atomic mass of chlorine (Cl) is 35.45 amu because chlorine is composed of several isotopes, some (the majority) with an atomic mass of 35 amu (17 protons and 18 neutrons) and some with an atomic mass of 37 amu (17 protons and 20 neutrons).
Hope it helped!!!
4. What domain name should replace the question mark in this chart?
5 points
Unicellular Protozoa
Uni/multicellular
algao
Multicollular
heterotroph
cell walls chitin
?
Multicoulluar
autotroph
cell walls
of cellulose
Multicellular
heterotroph
Lack cell walls
O a. Archaea
b. Bacteria
O c. Eukarya
O d. Monera
Answer:
C. Eukarya
Explanation:
If you were an Amazon ant, how would you eat?
a. You would cultivate a special fungus
b. You would feed off the nectar produced by caterpillars
c. You would consume the pheromones produced by
other ants
d. You would be fed by "slave" ants from other species
Answer:
A
Explanation:
you have make your own cultivation so that you will no any else where for food
Crocuses can bloom in the winter, while dahlias bloom in the fall. This is due to different responses to daylight length or _________.
A. Sun rays
B. Photoperiodism
C. phototropism
D. geotropism
Answer:
It's becoz of sun rays.....
Please help!!!! Grizzly bears and polar bears are very closely related, so much so that they can reproduce to form hybrid offspring. Use your understanding of natural selection to describe how polar bears became a separate classification from the grizzly.
Scientists believe that at first these bears scavenged seal carcasses that had washed ashore, and gradually began to hunt the seals by waiting at the water's edge as the seals surfaced to breathe. This is believed to be an important step in the evolution of a new bear species, the polar bear
Over time the new polar bears were used to the cold climate and learnt how to fish, they then separated from the grizzly bears, they developed new creatures which would help them survive in one of the most dangerous climate.
Polar bears become separate classification from the grizzly by the natural selection known as divergent and adaptive evolutionary change.
Polar bears and grizzly bears are considered as closed to one another so they can interbreed. They both diverged from one another due to the harsh climate of the Arctic and the ecology of the region.
The changes that took place are camouflaging and pigment-free fur-coat that helped them in order to adapt to the different climates.The genetic mutation leads to such Adaptive changes when the polar bears migrated northwards.The populations living in different climates undergo natural selection that is divergent natural selection and the adaptive evolutionary changes that result in different species.Learn more about speciation:
https://brainly.com/question/4493180
Note: your teacher will review your response to this question to ensure you receive proper credit for your answer. The pH scale is a measurement system that indicates the concentration of _______ in solution.
please help
Answer:
hydrogen and hydroxide ions
Explanation:
The pH scale indicates the concentration of hydrogen ions (H+) and hydroxide ions (OH-) in a solution.
How long will it take a cross country runner to cover a distance of 350 meters at a speed of 17.5 m/min?
Answer:
20 minutes
Explanation:
Divide distance by speed to get time
D/S = t
350/17.5 = 20
(Just an fyi you posted this in biology)
How many moles are present in 10, 0 grams of sodium hydroxide (NaOH )
Answer:0.250 mols
Explanation:
That’s the answer I got it wrong using the guy that previously wrote that the answer is 19 mols his totally wrong don’t trust him
We have that Moles that are present in 10, 0 grams of sodium hydroxide (NaOH ) is
Moles\ NaOH =0.25moles
From the question we are told
How many moles are present in 10, 0 grams of sodium hydroxide (NaOH )
Generally the equation for the Molar mass of sodium hydroxide is
[tex](NaOH) = (22.990 + 15.9994 + 1.008) \\\\ {(NaOH)} = 40 g/mol[/tex]
Where
Mass_{NaOH}taken = 10 g.
[tex]Moles\ NaOH =\frac{(mass of NaOH taken)}{(molar mass of NaOH)}\\\\Moles\ NaOH = \frac{10}{(40}\\\\Moles\ NaOH =0.25moles[/tex]
Therefore
Moles that are present in 10, 0 grams of sodium hydroxide (NaOH ) is
Moles\ NaOH =0.25moles
For more information on this visit
https://brainly.com/question/17756498
15 Which of the following mutations would have the potential to affect future
generations of a species?
A A frame shift mutation in the X chromosome of a cheek cell
B A chromosomal mutation in the Y chromosome of a kidney cell
CA point mutation in the first chromosome of a sperm cell
D A substitution mutation in the third chromosome of a uterus cell
Answer:
c i think
Explanation:
I don't know just trying to help hope you have a good day
please help me with this biology question.............
Why is the use of electron microscopy important in studying cells ??
Explanation:
Electronic microscope helps us to see each every part of the cell. So, it is considered important
Answer:
A cell is the smallest unit of life. Most cells are so small that they cannot be viewed with the naked eye. Therefore, scientists must use microscopes to study cells. Electron microscopes provide higher magnification, higher resolution, and more detail than light microscopes.
Explanation:
hope it's help you
Which of the following has the highest reproductive potential?
O a. bacteria
O b. cattle
O c. humans
O d. elephants
Answer:
A. Bacteria
Explanation:
I asked my teacher hahahahahahahaha
Bacteria as the highest reproductive potential. Hence option a is correct.
What is reproductive potential?Reproductive potential is defined as the proportional ability of a species to reproduce itself under ideal circumstances. The maximum number of children that a particular organism can produce is known as its reproductive potential. Compared to other species, some have substantially higher reproductive capacity.
When people reproduce more frequently, sooner in life, and at higher rates, their reproductive potential rises. The largest influence on reproductive capacity is early pregnancy. Every living thing must be able to reproduce. All living things produce additional organisms that resemble them.
Thus, bacteria as the highest reproductive potential. Hence option a is correct.
To learn more about reproductive potential, refer to the link below:
https://brainly.com/question/28276770
#SPJ6