please can you help me thanks

Please Can You Help Me Thanks

Answers

Answer 1

Answer:

Step-by-step explanation:

mode means most repeated number . here in this given data 7 is repeated maximum number of times . so mode is 7.

to find median arrange the data from ascending to descending order.

Data = 1,2,3,4,5,7,7,7,8,8

median = N + 1/2    (N means no of data )

=10 + 1/2

=11/2

=5.5

= 5th term + 6th term/2

=5+7/2

=12/2

=6

mean = sum of data / no of data

=3+7+2+4+7+5+7+1+8+8/10

=52/10

=5.2

range = largest value - smallest value

=8 - 1

=7


Related Questions

On a piece of paper, graph y = 3x - 2. Then determine which answer choice
matches the graph you drew. Find the slope of the line.
Identify the solution that has the correct graph and the correct slope.

Answers

Answer:

NOT  A or B

probably C ?

Step-by-step explanation:

Which statements regarding the vertex of a quadratic function are true? Select all that apply.

Answers

what are the answers that you can pick from?

Answer:

the rules regarding the vertex of a quadratic function are:

the parabola opens up, the vertex represents the lowest point on the graph, or the minimum value of the quadratic function. If the parabola opens down, the vertex represents the highest point on the graph, or the maximum value. In either case, the vertex is a turning point on the graph.

Hope This Helps!!!

What is the area of this figure? Round to the tenth if necessary.

Answers

Answer:

b) 850.1 centimeters.

Step-by-step explanation:

To find the area of this figure, we must first find the areas of the shapes that compose this figure.

This figure is made up of a rectangle and a semicircle.

Remember: To find the area of a semicircle, multiply the radius by itself twice, then multiply the product pi, lastly divide the product by 2.

[tex]a=\pi r^2/2[/tex]

3.14 will be used for pi!

To find the area of a rectangle, multiply the length by the width. The product is the area of the rectangle.

[tex]a=lw[/tex]

Now, let's solve.

The diameter of the semicircle is 32 centimeters.

To find the radius of a semicircle, divide the diameter by 2.

[tex]32/2=16[/tex]

The radius of the semicircle is 16 centimeters.

Now that we have the radius, we can find the area of the semicircle.

[tex]\pi 16^2/2=401.92[/tex]

The area of the semicircle is 401.92 centimeters.

Furthermore, we find the area of the rectangle.

[tex]14*32=448.[/tex]

The area of the circle is 448 centimeters.

Next, we add the areas of both shapes to find the area of this figure.

[tex]401.92+448[/tex]

[tex]=849.92[/tex]

The final step is to round 849.92 to the nearest tenth.

Even though 849.92 to rounded to the nearest tenth is 849.9, there is no answer choice for this. The closest one to this answer is choice 'b.'

I, therefore, believe the area of this figure is 850.1 centimeters.

The pH of a solution is a measure of the quantity of hydrogen atoms (H) in the solution. It is given by the formula f(x) = −log x. In the formula, x = [H+], the molar concentration of hydrogen atoms, or the number of moles of hydrogen atoms per liter of solution

Answers

The question is incomplete. The complete question is :

The pH of a solution is a measure of the quantity of hydrogen atoms (H) in the solution. It is given by the formula f(x) = −log x. In the formula, x = [H+], the molar concentration of hydrogen atoms, or the number of moles of hydrogen atoms per liter of solution

The approximate molar concentration of several chemicals are given. Find the pH of each. Use the calculator and round to the nearest tenth, if necessary.

Oven cleaner: [H+] = 10−13 pH =

Water: [H+] = 0.0000007 pH =

Blood: [H+] = 0.00000004 pH =

Vinegar: [H+] = 0.0063 pH =

Solution :

Given formula :

f(x) = −log x

Here,  x = [H+] = molar concentration of hydrogen atoms

Therefore, the pH of each of the following solution are :

Oven cleaner

[[tex]$H^+$[/tex]] = [tex]$10^{-13}$[/tex]

pH = - log [[tex]$H^+$[/tex]]

     = [tex]$- \log 10^{-13}$[/tex]

     = 13

Water

[[tex]$H^+$[/tex]] = 0.0000007

pH = - log [[tex]$H^+$[/tex]]

     = - log 0.0000007

     = 6.2

Blood

[[tex]$H^+$[/tex]] = 0.00000004

pH = - log [[tex]$H^+$[/tex]]

     = - log 0.00000004

     = 7.4

Vinegar

[[tex]$H^+$[/tex]] = 0.0063

pH = - log [[tex]$H^+$[/tex]]

    = - log  0.0063

    = 2.2

     

someone PLSSS HELPPP fast plsss !!!

Answers

5a^10-2 I’m pretty sure that’s the right answer

Emma wants to give someone 5.2m every day she can donate 10k how long will it take her to donate 5.2m?

Answers

Answer:

520 days

Step-by-step explanation:

--------------------------------------

5.2 million = 5,200,000

10 thousand = 10,000

5,200,000 ÷ 10,000 =

= 520 days

---------------

Hope this helps.

Answer:

520 days

Step-by-step explanation:

thanks for the pts

✌️❤️✌️

Change 1/3 to a decimal number (show the working)​

Answers

Answer:

0.33

Step-by-step explanation:

1/3 can also be written as 1 ÷ 3 which equals 0.33

Answer:

0.333333333

Step-by-step explanation

Pls answer……………………..

Answers

Answer:

Step-by-step explanation:

J and k are parallel if

angle 1 = angle 4 (vertically opposite angles)

angle 2 + angle 5 = 180 degree (being co interior angles)

angle 4 = angle 5 (being alternate interior angles)

angle 1 = angle 5 (being corresponding angles)

Answer:

2 and 5 are co - interior angles

1 and 3 are corresponding angles

1 and 4 are alternate

6 and 8 are corresponding angles

Step-by-step explanation:

What is the solution to the equation
[tex] \frac{1}{4} x + 2 = - \frac{5}{8}x - 5 [/tex]

Answers

Answer: 56/3

Explanation: hope this helps

Expand.
Your answer should be a polynomial in standard form.
(x - 4)(x - 6) =

Answers

Answer:

x^2 - 10x + 24

Step-by-step explanation:

(x - 4)(x - 6)

x(x - 6) -4(x - 6)

x^2 -6x -4x + 24

x^2 - 10x + 24

Answer:

[tex] {x}^{2} - 10x + 24[/tex]

Step-by-step explanation:

[tex](x - 4)(x - 6) \\ = x(x - 6) - 4(x - 6) \\ = {x}^{2} - 6x - 4x + 24 \\ = {x}^{2} - 10x + 24 \\ [/tex]

Question 2 (Essay Worth 10 points)
(03.01 MC)

Look at the rectangle and the square:

A rectangle PQRS and square LMNO are drawn side by side. The length SR of the rectangle is labeled as 12 inches, and the width QR is labeled as 6 inches. The side LM of the square is labeled as 6 inches.

Sam says that the length of diagonal SQ is two times the length of diagonal OM.

Is Sam correct? Justify your answer and show all your work. Your work should state the theorem you used to find the lengths of the diagonals.

Answers

Answer:

Sam is incorrect.

Step-by-step explanation:

Using Pythagorean Theorem, we can find the length of diagonal SQ as 13.4 (6^2 + 12^2 = c^2, 36 + 144 = c^2, sqrt(180) = c, c is approx 13.4). We can do the same for diagonal OM (6^2 + 6^2 = c^2, 36 + 36 = c^2, 72 = c^2, sqrt(72) = c, c is approx 8.5). Sam is therefore incorrect because 13.4 is not double of 8.5.

Answer:

Sam is incorrect.

Step-by-step explanation:

Sam is incorrect. By using the Pythagorean theorem, we can find out what each diagonal is equal to.

Starting with diagonal SQ...

6^2 + 12^2 

= 36 + 144

= 180

Square root of 180?

= 13.41

Diagonal OM...

6^2 + 6^2 

= 36 + 36

=  72

Square root of 72?

 = 8.48

Therefore, Sam is incorrect because 8.4 isn't half of 13.4.

The equation x^2+ y^2+ 8x - 12y + 43 = 0 is the equation of a circle. Complete the square to change this
equation to standard form. Find the radius and the coordinates of the center of the circle and then graph the
circle.

Answers

Answer:

ans: centre of circle is ( -4 , 6 )

and radius is 3 unit

What value of x is in the solution set of 9(2x + 1) < 9x - 18?
-4
-3
-2
-1

Answers

Answer:

The only possible answer that is correct is the first one, x = -4.

Step-by-step explanation:

Simplify the given inequality as much as possible, and then substitute each of the given x values one by one to determine which is in the solution set.

9(2x + 1) < 9x - 18 becomes 18x + 9 < 9x - 18, which, if reduced by dividing all four terms by 9, becomes 2x + 1 < x - 2.

Simplifying further, we get x < - 3.  The only possible answer that is correct is the first one, x = -4.  -4 < -3 is true.

Step-by-step explanation:

9(2x + 1)<9x - 1818x + 9 < 9x - 1818x - 9x < - 18 - 99x < 27x = 27/9x = 3.

When drawn in standard position, in which quadrant does the terminal side of the angle −240° lie?

Answers

Answer:

Option (2)

Step-by-step explanation:

All angles are positive when measured counterclockwise from the x-axis.

Terminal side of 240° degrees when measures counterclockwise will lie in the 3rd quadrant.

But the angle is -240°.

That means angle is being measured clockwise from the x-axis.

Therefore, terminal side of the of the angle will be in the 2nd quadrant.

Option (2) will be the correct option.

A food sample contains 300 bacteria. The doubling time for bacteria left at room temperature is 20 minutes. How many minutes will it take to reach an unsafe level of 100000 bacteria?

Answers

Answer:

167.6 minutes

Step-by-step explanation:

The formula is given as:

P(t) = Po × (2)^t/k

Where

P(t) = Population after time t = 100000

Po = Initial population = 300

k = Doubling time = 20 minutes

t = Time = ?

Hence:

100000 = 300 × (2)^t/20

Divide both sides by 300

100000/300 = (300 × (2)^t/20)/300

333.3 = 2^t/20

Take the In of both sides

In 333.3 = In (2^t/20)

In 333.3 = t/20 In 2

Divide both sides by In 2

In 333.3/In 2 =( t/20 In 2)/In 2

8.3806775072 = t/20

Cross Multiply

t = 8.3806775072 × 20

t = 167.61355014 minutes

Approximately = 167.6 minutes

Therefore, the time it will take to reach an unsafe level of 100000 bacteria is 167.6 minutes

if 24= 2f+3f+f, find f​

Answers

Answer:

6f = 24

f = 4

Step-by-step explanation:

[tex]\huge\textsf{Hey there!}[/tex]

[tex]\textsf{24= 2f + 3f + f}\\\text{COMBINE the LIKE TERMS}\\\\\textsf{2f + 3f + f}\\\textsf{2f + 3f = \bf 5f}\\\textsf{5f + f}\\\textsf{= \bf 6f}\\\text{New equation: \textsf{6f = 24}}\\\text{DIVIDE 6 to BOTH SIDES}\\\mathsf{\dfrac{6f}{6}=\dfrac{24}{6}}\\\textsf{CANCEL out: }\mathsf{\dfrac{6}{6}}\textsf{ because that gives you 1}\\\textsf{KEEP: }\mathsf{\dfrac{24}{6}}\textsf{ because that helps solve for the f-value}\\\\\mathsf{\dfrac{24}{6}=\bf f}\\\\\\\mathsf{\dfrac{24}{6}=24\div6=\bf 4}[/tex]

[tex]\boxed{\boxed{\large\textsf{Answer: \huge \bf f = 4}}}\huge\checkmark[/tex]

~[tex]\large\textsf{Good luck on your assignment and your day!}[/tex]

~[tex]\frak{Amphitrite1040:)}[/tex]

Figure ABCD is a parallelogram.

Parallelogram A B C D is shown. The length of A B is 4 y minus 2, the length of B C is 2 x + 2, the length of D C is 2 y + 6, and the length of A D is 3 x minus 1.

What is the perimeter of ABCD?

14 units
38 units
44 units
49 units

Answers

Answer:

It is 44

Step-by-step explanation:

The perimeter of the paralllelogram given is: 44 units.

What is the Perimeter of a Parallelogram?

Perimeter = 2(a + b), where a and b are the legs of the sides adjacent to each other.

Given the following:

AB = 4y - 2BC = 2x + 2DC = 2y + 6AD = 3x - 1

Since opposite sides of a parallelogram are equal, therefore:

4y - 2 = 2y + 6

4y - 2y = 2 + 6

2y = 8

y = 4

2x + 2 = 3x - 1

2x - 3x = -2 - 1

-x = -3

x = 3

Perimeter of the paralllelogram = 2(AB + AD) = 2(4y - 2 + 3x - 1)

Plug in the values of x and y

Perimeter of the paralllelogram = 2(4(4) - 2 + 3(3) - 1)

Perimeter of the paralllelogram = 2(16 - 2 + 9 - 1)

Perimeter of the paralllelogram = 44 units.

Learn more about perimeter of a parallelogram on:

https://brainly.com/question/10919634

If you have 36 ft of fencing, what are the bases and side lengths of the different parallelograms you could enclose with the fencing? Consider only whole-number dimensions.

Answers

Answer:

[tex](l,w) = (1,17)[/tex]

[tex](l,w) = (2,16)[/tex]

[tex](l,w) = (3,15)[/tex]

---

---

-

[tex](l,w) = (9,9)[/tex]

Step-by-step explanation:

Given

[tex]P = 36ft[/tex] --- perimeter

[tex]l \to length[/tex]

[tex]w \to width[/tex]

Required

Possible dimension of different parallelogram

The perimeter is calculated as:

[tex]P=2(l+w)\\\\\\[/tex]

So,we have:

[tex]2(l+w)=36[/tex]

Divide by 2

[tex]l + w = 18[/tex]

Since l and w must be positive integers, the possible dimensions are:

[tex](l,w) = (1,17)[/tex]

[tex](l,w) = (2,16)[/tex]

[tex](l,w) = (3,15)[/tex]

---

---

-

[tex](l,w) = (9,9)[/tex]

Solve for X:
-2(x+2) < 14

Answers

Answer:

answer is 45 + 5 so it's 50

Answer:

-2X-4<14

-2X<18

X>9

Step-by-step explanation:

The problem has been started for you.


What is the quotient?
86
86.6
86.ModifyingAbove 6 with bar
87

Answers

Answer:

the third one

Step-by-step explanation:   6  22  22  24

the quotient is 86.6666666   the repeating 6 is sometimes written with a bar above the .6  like

   

86.6   except the bar is on top of the second 6

What is the total number of digits required in numbering the pages of a book, which has 1, 150 pages?

Answers

Answer:

3,493 digits

Step-by-step explanation:

Total pages of the book = 1,150

Page 1 - 9 = 9 digits

Page 10 - 99

= 2 * 90 pages

= 180 digits

Page 100 - 999

= 3 × 900 pages

= 2,700 digits

Page 1000 - 1,150

= 4 × 151 pages

= 604 digits

Total digits required in numbering 1,150 pages = 9 + 180 + 2,700 + 604

= 3,493 digits

Total digits required in numbering 1,150 pages = 3,493 digits

Use the following to write and solve a proportion to find the values of X, Y and Z. ​

Answers

Answer:

x = 48-32 = 16

y = 32/16 × 10 = 20

z = 48/32 × 26 = 39

Mario sells electronics at Big Box Electronics Store. He is paid a salary of $250 a week
plus 7% commission on his sales.
a) Write an equation for the line, in slope/y-intercept form, representing his weekly
earnings, E, where Sis his weekly sales. Put this answer into Blank #1.
b) Identify the slope. Put this answer into Blank #2.
c) What does the slope represent? Put this answer into Blank #3.
c) What does the E-intercept represent? Put this answer into Blank #4.
d) What were Mario's sales in the week he earned $530? Put this answer into Blank
#5.
Blank # 1
Blank # 2
Blank # 3
Blank #4
Blank # 5

Answers

Answer:

Step-by-step explanation:

E = 0.07s + 2500.07Salary per weekWhat he makes if he doesn't sell anything that week $4000

(Find m∠RTS) m∠RTS=

Answers

Answer:

[tex]m\angle RTS=34^{\circ}[/tex]

Step-by-step explanation:

From the Isosceles Base Theorem, the two base angles of an Isosceles Triangle are equal. Therefore, [tex]m\angle RTS=m\angle TRS[/tex].

Since the sum of the interior angles of a triangle is 180 degrees, we have:

[tex]m\angle RTS +m\angle TRS+112=180,\\2\cdot m\angle RTS+112=180,\\2\cdot m\angle RTS=68,\\m\angle RTS=\boxed{34^{\circ}}[/tex]

De las ventas obtenidas en el mes de enero , el dueño de " La chiquita " tiene la obligación de entregar el 16 % de IVA . Si en un mes se vendieron en la tienda $80,000 ¿ Cuánto tendrá que reportar de IVA al gobierno ?

Answers

Answer:

The amount paid as VAT is $ 12800.

Step-by-step explanation:

Sales = $ 80,000

VAT = 16 %

The amount of VAT paid to the government is

= 16 % of $ 80,000

= 0.16 x $ 80,000

= $ 12800

The amount paid as VAT is $ 12800.

The money m (in £) Billy has to spend each week is his wage w (in £) subtract the tax t (in £) he pays on his income. Enter a formula for the money he can spend and enter how much he has to spend if he earns £150 a week and pays £42 in tax.

Answers

Answer:

m = w - t

£108

Step-by-step explanation:

m = Money Billy has to spend per week :

m = wage, w - tax, t

Hence,

m = w - t

Given;

Wage = £150 ; tax = £42

m = £150 - £42

m = £108

What is Euclid's fifth postulate?

How would you rewrite Euclid’s fifth postulate so that it would be easier to understand?​

Answers

Step-by-step explanation:

espero que te ayude amigo

Kofi and Kojo were given 380 cedis to share, Kojo had 15 cedis more than Kofi. If Kofi's share is x, find an expression for Kojo's share.Hence find how much each received.

Answers

Answer:

kojo = x + 15

kofi = $182.50

kojo = $197.50

Step-by-step explanation:

kofi = x  

kojo = x + 15 (since Kojo h as 15 cedis more than Kofi)

380= x + 15 + x

2x + 15 = 380

combine like terms

2x = 380 - 15

2x = 365

x = 182.50

Kojo = 15 + 182.50 = $197.50

Help me or Shrek's donkey won't get pancakes!

Answers

Answer:

A. y=x and y=x+2

Step-by-step explanation:

A.

y=x and y=x+2

The equations both match the slope and intercept of the graphed equations.

Can I have the pancakes instead of the donkey?

3. A student gets a grant of $10 000 a year. Assuming her grant is increased by 7% each year, what will her grant be in four years time? ​

Answers

Answer:

that's all~~~~~~~~~~~~~~~~~~

Other Questions
Cho hai in tch q1=q2=8.10^-7 C t cch nhau 5cm. Xc nh cng in trng ti im:a. Cch q1=2cm, q2=3cmb. Cch q1=5cm, q2=10cmc. Cch q1=5cm, q2=5cmd. Cch q1=4cm, q2=3cm Why does Australia have such unique biodiversity (variety of animals and plants) in its fauna and flora? Apothem=A) 4 units B) 4 (square root) 2 units C) 4 (square root) 3 units Solve for x. 8x = 35 A brick staircase has a total of 17 steps The bottom step requires 131 bricks. Each successive step requires 5 less bricks than the prior one. How many bricks are required to build the staircase? Evaluate x2+9/x2 for each of the given values.What is the value of the expression when x = 3?2310undefinedWhat is the value of the expression when x = 1?2310 undefinedWhat is the value of the expression when x = 0?2310undefined A supervisor is suspicious of a new female employee in an automotivecompany. This is an example of...DiscriminationDiversityPrejudiceTolerance Four relatively recent fossil species were recovered, and when the DNA was extracted, investigators observed that Species W and Z both had long finger bones, and species X and Y had short finger bones. Based upon this information and the hypothetical molecular data below, sequenced from common regions in one gene of their DNA, which two species are the most closely related to each other?Species W:AACATTGCTTTTGTAACGAASpecies X:AACCGCGCGTTTGGCGCGCASpecies Y:AGCAGCGCTTTCGTCGCGAASpecies Z:AACCGCGCTTTTGGCGCGAAA) Species X and ZB) Species W and ZC) Species Y and ZD) Species X and Y Our town has ____ museum we could visit Which of the relations below is a function? *2 points{(2, 3), (3, 4), (5, 1), (2, 4)}{(2, 3), (3, 4), (6, 2), (7, 3)}{(2, 3), ( 3, 4), (6, 2), (3, 3)}{(2, 4), ( 3, 4), (6, 3), (3, 3)} PLEASE HELP, WILL GIVE BRAINLIEST FOR RIGHT ANSWER!Indicate the equation of the given line in standard form, writing the answer in the equation box below. The line that contains the point Q (1, -2) and is parallel to the line whose equation is y 4 = 2/3 ( x 3) Activity: write 3 three sentence about the picture. use the correct forms of adjectives in your sentence What type of force are you exerting when you lie on a bed?A. Electric forceB. Magnetic forceC. CompressionD. Tension The first step in the control process is ________. A) setting the desired moralsB) measuring actual performanceC) comparing performance against expectations D) applying managerial control necesito informacin sobre doble toque en voleibol Pls help me answer this :,(What is the equation of the quadratic graph with a focus of (5, 6) and a directrix of y = -12? Does anyone know the answers with big ideas! In Act I, scene ii, Claudiuss mention of Fortinbras raises the issue of _____. the cause of King Hamlets death how Fortinbras is better than Hamlet an external threat to Denmark corruption in Denmarks government Research a modern-day pioneer who became famous for accomplishing something great or moving humanity forward. Someone like Albert Einstein, Orville and Wilbur Wright, or Walt Disney.Analyze and identify how this person maintained a youthful outlook and introduced energy and excitement into their life.Write a short paragraph on one of their great accomplishments, and why they were passionate enough to see it through. Share your short paragraph and a picture of the person on one of your social media pages. What kind of comments did you get from your post? Upload a screenshot of your post here. ng lc qu trnh truyn khi l g? Khi qu trnh truyn khi xyra, ng lc truyn khi xy ra nh th no ?