what are two simple, matching equations (mathematical)

Answers

Answer 1

Answer:+, -

Step-by-step explanation:

Answer 2
You answer could be: |-1/2| & 1/2


Don’t know if you’re working with fractions or what lol but there’s that basically the absolute value of negative one half and positive one half.

Related Questions

Caden rolls two fair number cubes numbered from 1 to 6. He first defines the sample space, as shown below:

(1, 1), (1, 2), (1, 3), (1, 4), (1, 5), (1, 6)
(2, 1), (2, 2), (2, 3), (2, 4), (2, 5), (2, 6)
(3, 1), (3, 2), (3, 3), (3, 4), (3, 5), (3, 6)
(4, 1), (4, 2), (4, 3), (4, 4), (4, 5), (4, 6)
(5, 1), (5, 2), (5, 3), (5, 4), (5, 5), (5, 6)
(6, 1), (6, 2), (6, 3), (6, 4), (6, 5), (6, 6)

Based on the sample space, what is the probability of getting a total of 6? (5 points)

a. 5 over 36
Selected:b. 6 over 36This answer is incorrect.
c. 7 over 36
d. 8 over 36

Answers

Answer:

B. 6 over 36

Step-by-step explanation:

As we are given the sample space, the events that sum to 6 are:

{(1,5), (2,4), (3,3),(4,2),(5,1)}

Let n(S) be the number of items in sample space

n(S) = 36

Let E be the event the sum is 6

Then,

n(E) = 6

So,

P(Sum of two cubes is 6) = n(E) / n(S)

= 6/36

So, the correct answer is:

B: 6/36

Answer:

B. 6 over 36

Step-by-step explanation:

can someone help me please? I know that I will be using the theoretical probability equation, but I just don’t know what to do

Answers

Answer:

Step-by-step explanation:

Hi there,

We know that a pair means two and so for each pair of socks he has, we are going to multiply that number by two to find the individual amount.

White socks: 2 pairs x 2 = 4 total white socks

Black socks: 4 pairs x 2 = 8 total black socks

Blue socks: 1 pair x 2 = 2 total blue socks.

Now, you add up the total amount of individual socks in the drawer.

4+8+2 = 14 socks.

We are trying the find the probability that he is going to pick a black sock.  The amount of black socks is going to go on the numerator of the fraction and the total amount of socks in the drawer is going to go on the denominator.

8 black socks  /  14 total socks

Now that we have this fraction, we need to simplify it.  The number 8 and 14 are both divisible by 2, so we now have the fraction (4/7).

What this means is that, theoretically, if he randomly pulled out 7 socks, that 4 of the socks he pulls out should be black, leaving the probability he picks out black socks to be (4/7) of the time or about 57% likely to happen.

I hope this helps, let me know if you have questions :)

The language arts teacher wants to know whether the students in the entire school prefer a debate or an speech. The teacher draws a random sample from the following groups:

All teachers in the school
All boys in each grade
All students in the speech club
All students in each grade
Which group best represents the population she should take a random sample from to get the best results for her survey? (5 points)

a
All teachers in the school

b
All boys in each grade

c
All students in the speech club

d
All students in each grade

Johnny wants to know how many students in his school enjoy watching science programs on TV. He poses this question to all 26 students in his science class and finds that 75% of his classmates enjoy watching science programs on TV. He claims that 75% of the school's student population would be expected to enjoy watching science programs on TV. Is Johnny making a valid inference about this population? (5 points)

a
Yes, it is a valid inference because his classmates make up a random sample of the students in the school

b
Yes, it is a valid inference because he asked all 26 students in his science class

c
No, it is not a valid inference because he asked all 26 students in his science class instead of taking a sample from his math class

d
No, it is not a valid inference because his classmates do not make up a random sample of the students in the school
A researcher posts a magazine advertisement offering $30 in exchange for participation in a short study. The researcher accepts the first three people who respond to the advertisement. Which of the following statements is true about the sample? (5 points)

a
It is not a valid sample because it is not a random sample of the population.

b
It is a valid sample because the first three people were selected to participate.

c
It is a valid sample because money was offered to participants.

d
It is not a valid sample because it is only a short study.

Answers

Answer:

Q1: D

Q2: D

Q3: B

Step-by-step explanation:

Q1: It says it in the question.

Q2: He asked the ones in his science class so they would obviously prefer science, but that is not true for the rest of the students.

Q3: It is random because the first 3 people were chosen regardless of who they were, and it is still a valid sample even if the study is short.

D, D,B, that’s what I think is right

At the sewing store, Samantha bought a bag of mixed buttons. She got 400 buttons in all. 400 of the buttons were large. What percentage of the buttons were large?

Answers

100% of the buttons were large.
explanation
she got 400 buttons
400 were large
400/400 as a percent is 100%

Answer:100% of the buttons were large.

she got 400 buttons

400 were large

400/400 as a percent is 100%

Step-by-step explanation:

Explanation she got 400 buttons

400 were large

400/400 as a percent is 100%

pls help its over due

Answers

Your selected answer is correct. The 35 needs to be converted to 0.35 and then multiplied by 20.

___ is 35% of 20. So 0.35 x 20 = 7. The answer to the bottom left box is 7.

Answer:

The correct answer is 7

the table shows the possible outcomes of spinning the given spinner twice. Find the probability of the spinner landing on 1 at least once.

The probability is?

LOOK AT THE PICTURE AND PLEASE HELP!!

Answers

Answer: The probability or percentage of the spinner landing on 1 once is 36% or 9 out of 25.

Step-by-step explanation:

At a recent football game of 8,450 in attendance, 150 people were asked what they prefer on a hot dog. The results are shown.


Ketchup Relish Chili
54 36 60


Based on the data in this sample, how many of the people in attendance would prefer chili on a hot dog?
5,070
3,380
2,986
2,084

Answers

Answer: 3,380

Step-by-step explanation: THIS IS MY GUESS.

Since we know that 150 people were surveyed, and only 60 wanted chili, we can write an equation to get the percentage of people who wanted chili as 60/150. We can simplify that to get 6/15 and then simplify again to get 2/5. 2/5 simplifies to 40% as a percentage. 40% of 8,450 (or 0.4 x 8,450) would be 3,380.

Answer 3380
Explanation
We will find the ratio of 54 36 and 60 which is 9:6;10
So now total attendance is 8450.
So 8450 * 6 / 15= 3380

YALL! WHAT IS THE ANSWER?! HELP ASAP!
q:
choose the different ways that a graph can be misleading (select all that apply)
a:
1- the y-axis starts at zero and uses consistent intervals
2- different bar heights are used on the same graph
3- the y-axis doesn't start at zero
4- the intervals on the y-axis are too large
5- different bar widths are used on the same graph
6- the y-axis starts at zero but has different intervals

Answers

Answer:

Step-by-step explanation:

Here’s the answers :

6-The y -axis starts at zero but has different intervals.


5- Different bar widths are used on the same graph.


3- The y -axis doesn't start at zero.

Find the error(s) and solve the problem correctly.
Sarah was asked to solve the following problem. Identify her errors and explain how to correct her mistakes.

Answers

Answer:

[tex]5x^3-18x^2+2x+21[/tex]

Step-by-step explanation:

In the second step, -9x-21 should be 9x+21. This is because -3 in x-3, and -3x-7 in 5x²-3x-7 are both negative, so each term's product should be positive.

Also, in the third line, she wrote -3x²-15x² as -18x⁴ instead of -18x²,and similarly, she wrote -7x-9x as -16x² (however this is wrong anyway because step 2 was done incorrectly).

If we continued off from the second step with these corrected errors:

[tex]5x^3-3x^2-7x-15x^2+9x+21\\5x^3-18x^2+2x+21[/tex]

Therefore, the correct simplification is [tex]5x^3-18x^2+2x+21[/tex].

Answer:

5x^3-18^2 +2x +21

Step-by-step explanation:

Identify all of the quadratic functions

Answers

Answer:

y=(x-2)^2 +4

y=1/4 x^2 +x-1

please help me with these problems I will give brainlist

Answers

Step-by-step explanation:

Slope intercept form of a line is

y = mx + b      where    m = slope    b = intercept

1)   y = 2x + 4

3) y = -3/4 x  + 0   = - 3/4 x

I think you can see how to do the other two now......

Which answer choice best represents 50/15

?

Answers

Answer:

3 1/3

Step-by-step explanation:

       See attachment below

Answer:

Option (A) 3 1/3

Step-by-step explanation:

Let’s solve the improper fraction into a mixed fraction.

The simplified fraction will get a remainder but we I’ll not solve the remainder.

50/15

Quotient = 3

Remainder = 5

Fraction = 3 5/15

               = 3 1/3


Hope my answer helps you ✌️

Mark BRAINLIEST

PLS HELP MEEE All of the number sentences are true except.

7 3 = 343
4 2 = 16
6 3 = 18
11 2 = 121

Answers

Answer:

I think its the second one, 4 2 = 16. If not then the third one.. I hope this helps!

The answer is 6 3= 18

7x7x7=343
4x4=16
6x6x6=216
11x11=121

The stem-and-leaf plot below shows the percentage scores on a recent sixth-grade science test.

Use the stem-and-leaf plot to determine the mode of the test scores.

Answers

If 8 | 2 = 82%, then the mode is 74%.

7 | 4 appears the most often.

Can you please help?

Answers

Answer:

30.68 cm²

Step-by-step explanation:

Area of the shaded region

= Area of rectangle - Area of semicircle

Given,

Height (h) = 4.5 cm

Base (b) = 9 cm

Diameter (d) = 5 cm

Formula

Area of the rectangle = bh

Area of the rectangle

= 9 x 4.5

= 40.5 cm²

Formula

Radius (r) = d/2

r = 5/2

r = 2.5 cm

Formula

Area of the semicircle = πr²/2

Note

The value of π is 3.14

Area of the semicirlce

= (3.14 x 2.5²)/2

= (3.14 x 2.5 x 2.5)/2

= 19.625/2

= 9.8125 cm²

Area of the shaded region

= Area of rectangle - Area of semicircle

= 40.5 - 9.8125

= 30.6875 cm²

~ 30.68 cm² approximately

Find the surface area of the square pyramid shown. Label the net to help you.


I have to show work

Answers

Answer: 40 inches squared

Labels are in the pictures

Step-by-step explanation:

To find the surface area, find the area of each side.

Square (base) : side * side = 4*4 = 16

Triangle (sides) : (base * height)/2

Assuming each side is a isosceles triangle, the base 4/2 = 2

(2*6)/2 = 12/2 = 6

Since there are 4 triangles, we can multiply 6 by 4 to get the combined area. We then add the area of the square to get the final result.

6*4 + 16 = 24+16 = 40

Compare the two groups of data. Which statement is true?
A. On average basketball players are 4 inches taller than baseball players
B. On average basketball players are 9 inches taller than baseball players
C. On average basketball players are 2 inches taller than baseball players
D. On average basketball players are 3 inches taller than baseball players

Answers

Answer: A

Step-by-step explanation:

If you graph the difference, it is 4 inches since you are looking at the middle of the graph

Your answer would be A. On average basketball players are 4 inches taller than baseball players

whats the surface area? sorry if im annoying

Answers

Answer:

The surface area of a solid object is a measure of the total area that the surface of the object occupies.

Step-by-step explanation:

SA=2B+Ph

Find the area of each face. Add up all areas.

Pls answer this for me

Answers

Answer : B and D (the second option and the fourth option)

In total, there are 100 blocks. There are 4 boxes.
100/4 = 25 therefore B would work.
D would also work as 41-16=25 and 9+16 is also 25, meaning boxes C and D would be equal. Boxes A and B would also be equal as 32-7=25 and 18+7=25.


A would NOT work as 41-21 is equal to 20, meaning box C would be lacking 5 blocks. C would NOT work as whilst A and B would be equal, C and D would not be. E would also NOT work as nothing would be equal at all.
B: Remove all blocks and make four equal piles of 25, then put each pile in one of the boxes and D: Remove 7 blocks from box 1 and place them in box 2 and remove 16 block from box 3 and place them in box 4

HELPP!!

The table shows the possible outcomes of spinning the given spinner twice. Find the probability of the spinner landing on 1 at least once.

The probability is?

Type an integer or a fraction

Answers

Answer: 7/16

Step-by-step explanation:

Hope this helps! Just find the number that fit the criteria (at least 1 one), and divide it by total outcomes/possibilities.

100 PTS *MIDDLE SCHOOL 7th GRADE***** HELP PLEASE!

Answers

Answer: x=108 degrees

Step-by-step explanation:

Since ST is a straight line, it measures 180 degrees.

This means that

x+(2/3)x=18


The simplified version is 5x/3=180. Now, we multiply both sides by 3. The equation becomes 5x=540 you would divide 5 by both sides which is ultimately x=108.

Answer:

x=108 degrees

Step-by-step explanation:

We know that since ST is a line, it equals a total of 180 degrees.

Let's write an equation:

[tex]180=x+\frac{2}{3}x[/tex]

simplify

[tex]180=\frac{5}{3} x[/tex]

divide both sides by 5/3

108=x

So, x=108 degrees.

Hope this helps! :)

PLEASE HELP I NEED THE ANSWER ASAP!!
(100 POINTS IF RIGHT!!!!!)

Answers

Answer:

1/2

Step-by-step explanation:

If the fraction of the box of pancake mix that Merida uses on Friday is not given, it is difficult to determine the exact fraction that she used on Saturday. However, if we assume that the fraction of the box of pancake mix used on Friday is 1/2 (which is a common amount for a recipe that serves 4-6 people), then we can solve for the fraction used on Saturday.

On Friday, Merida used 1/2 of the box of pancake mix.

On Saturday, she used 1 times as much pancake mix as Friday, or 1/2 * 1 = 1/2 of the box of pancake mix.

Therefore, Merida used 1/2 of the box of pancake mix on Saturday.

Note that if the fraction used on Friday is different, the fraction used on Saturday will also be different.

1/2 I took the test so it’s right

Give the measure of the angle that is complementary to the given angle. (Example 1)

Answers

Answer:

45

70

36

52

20

130

Step-by-step explanation:

complementary means it adds up to 90 degrees.

subtract that angle from 90 to get the complementary angle

supplementary angles add up to 180 degrees

subtract that angle from 180 to get the supplementary angle

Answer:

1) 45

2) 60

3) 36

4) 52

5) 20

6) 130

Step-by-step explanation:

In the first 3 questions, it's asking us for a complementary angle to the given angle.  A complementary angle is when 2 angles add up to 90 degrees.  So, we are given 45 degrees already, so we can subtract that from 90 to find it's complementary angle, which is also 45.  Continue to subtract from 90 for the next 2 problems.

In questions 4-6, we are asked to find an angle that is supplementary.  A supplementary angle is when 2 angles add up to 180 degrees.  We are given an angle that measures 128 degrees, so subtract 180-128 to get 52 degrees.  Continue subtracting from 180 for the next 2 problems.

Hope this helps! :)

Calculate the average (arithmetic mean) of the list of numbers shown in the table. (rounded to the nearest tenth)
Responses
A 39.139.1
B 44.044.0
C 39.039.0
D 35.235.2
E 39.2

Answers

Answer:

 

The answer is B. 39.0

Step-by-step explanation:

To find the average we add all the numbers then divide it by the total amount of numbers

= 23 + 33 + 33 + 27 +25 + 68 + 27 + 44 + 72/9

= 352/9

= 39.111111111

Round it of to the nearest tenth

= 39.0

100 PTS PLS HELP PLS PLS PLS PLSPLSPLPLSSPLSPLSLS

Answers

Answer:

D

Step-by-step explanation:

Lets go through each answer choice and check if it is correct.

A: False. 50% of 70 is not 31.

B: False. 17% of 70 is not 17.

C: False. The fraction 8/70 does not simplify to 2/25.

D: Correct. The fraction 14/70 simplifies to 2/10.

Answer:

The answer is D, On average, 2 out of 10 adults visited the museum most frequently.

Step-by-step explanation:

You can find this out by finding out how many adults there was total. You would do 31+14+17+8=70 and the you can see that 14 went to the museum so it would be 14/70. This fraction simplifies to 2/10.

Which number describes the median of the data given in the table?
Responses
A 24.224.2
B 2323
C 2222
D 2828
Question 2
Which number describes the range of the data given in the table?
Responses
A 66
B 2323
C 2222
D 28

Answers

The number which describes the median of the data given in the table is 23. option B.

The number which describes the range of the data given in the table is 6. Option A.

What is the median and range of the data given in the table?

Arrange the average gas mileage in ascending order

22, 22, 23, 26, 28

The median of a data refers to the middle number of the data set when arranged either in ascending order or descending order.

The median is 23

Hence, the range of the data set refers to the difference between the highest and lowest data.

= 28 - 22

= 6

Read more on median and range:

https://brainly.com/question/13278246

#SPJ1

Work out the area of the trapezium
(some please help, i forgot how to do this )

Answers

Answer:

48cm

Step by step:

The area of a trapezoid can be found using the formula A=(1/2)(b1+b2)h, so we replace each variable with what is written on the trapezoid. A=(1/2)(7+9)(6), so once you simplify you get 48.

Answer:

The area of the Trapezium is 48cm².

Step-by-step explanation:

A trapezium has a pair of Parallel Lines.

Let’s mark the line that is on the top as A and the bottom one as B.

Length of line A (Base 1) = 7cm

Length of line B (Base 2) = 9cm

Height of Trapezium = 6cm

Area of Trapezium (Formula) = {( Base 1 + Base 2 ) / 2} * Height

                                                 = {( 7cm + 9cm ) / 2} * 6cm

                                                 = ( 16cm / 2 ) * 6cm

                                                 = 8 cm * 6cm

                                                 = 48cm²

The area of the Trapezium is 48cm².


Hope my answer helps you ✌️

Mark BRAINLIEST

PLS HELPPPPPP *100 POINTS***

Answers

Answer:

6.9 if a triangle pyramid

Step-by-step explanation:

If triangle pyramid,

1/3(b)(h)

1/3(200)(h)=460

h=6.9

if it is a pyramid then 6.9

A decagon is a 10-sided figure.
Divide the decagon into triangles.

Answers

120 triangles can be divided from a decagon

Answer:

8 triangles

Step-by-step explanation:

Please help I'll give u brainleist!

Answers

Answer:

Step-by-step explanation:

probability you roll a one is 1/6

probability you roll an 8 is 0/6

add them and the answer is 1/6

Other Questions
A U.S. public company reported $8 million of goodwill in last year's balance sheet. How should the company calculate its reported goodwill for the current year?A. Determine whether the fair value of the reporting unit is less than the carrying amount and if so reduce the balance of goodwill and report an impairment loss on goodwill in the income statement.B. Calculate the yearly amortization, reduce the beginning balance, and report the current year's amortization expense.C. Determine whether the fair value of the reporting unit is greater than the carrying amount and if so increase the amount of goodwill and report the recovery of any previous impairment in the income statement.D. Determine whether the fair value of the reporting unit is greater than the carrying amount and if so increase the balance of goodwill and report a gain on goodwill in the income statement. c does not provide complete support for abstract data types What is the range of the circle above? earlier debates about divorce concerned the well-being of young children whose lives were disrupted by divorce. in the near future, debates about divorce will likely focus on ________. For the most part, the people who left Europe to settle elsewhere were In ____________________ connections, your computer dials up and connects to your ISP's computer only when needed.A. AepanetB. BroadbandC. Dial-upD. Bandwidth cheng is making a trip to her safe deposit box. what is she most likely planning to do?group of answer choices suppose the population of bears in a national park grows according to the logistic differentialdp/dt = 5P - 0.002P^2where P is the number of bears at time r in years. If P(O)-100, find lim Po) A study of blood pressure and age compares the blood pressures of men in three age groups: less than 30 years, 30 to 55 years, and over 55 years. Select the best method to analyze the data. a. Wilcoxon rank sum test b. Mann-Whitney test c. Kruskal-Wallis test d. Wilcoxon signed rank test Suppose that you borrow $10,000 on a 60-month car loan at 6.25% APR. Compute the monthly payment. a. Set up an equation for the problem using the following variables: n i pv pmt fv; where n=number of periods and i= interest rate per periodWhat is the actual formula?Does this one work? Part of a homeowner's insurance policy covers one miscellaneous loss per year, which is known to have a 10% chance of occurring. If there is a miscellaneous loss, the probability is c/x that the loss amount is $100x, for x = 1, 2, ...,5, where c is a constant. These are the only loss amounts possible. If the deductible for a miscellaneous loss is $200, determine the net premium for this part of the policythat is, the amount that the insurance company must charge to break even. if the enzyme-catalyzed reaction e s es e p is proceeding at or near the vmax of e, what can be deduced about the relative concentrations of s and es What is the floor of the House and Senate chambers?1. the place in each chamber where members of Congress vote on whether bills should be laws2. the place in each chamber where members of Congress stand to talk to constituents3. the place in each chamber where members of Congress give speeches about bills4. the place in each chamber where members of Congress investigate the possible effects of a bill Minerals can be classified based on cleavage or fracture. These two properties refer to the way in which a mineral tends to break. Cleavage is an orderly breakage in well-defined planes. It means that the broken piece of mineral will have flat and smooth sides. Fracture is a random breakage. If a mineral breaks with rough, random, uneven surfaces, it is said to have fractured. Because each of your mineral samples have already been broken from another, larger piece of a mineral, you should be able to tell if it has cleavage or fractures by looking at its sides. Of your 10 minerals, identify three that experienced cleavage. a cube-shaped gray mineral with smooth faces and sharp edges,a rust-colored mineral with a rough, uneven surface In "Bowling Alone," Robert Putnam discusses the reduced amount of social activity and civic engagement among U.S. adults during the past 40 years. Democratic governance, some have argued, depends to some degree on civic engagement and the social capital that it engenders. Putnam advances a number of reasons for the decline in civic engagement or the increase in "Bowling Alone." A leading hypothesis is that television viewing a solitary activity has replaced social activity as a primary form of leisure activity. The article was written a while ago. Today, he might extend that hypothesis to include the extent to which social media replaces conversation and social activity. Building on this information, please answer the following questions.1. What is the dependent variable in the hypothesis regarding television viewing?2. What is the independent variable in the hypothesis regarding social media?3. What is the hypothesized direction of the association between the independent and dependent variable in the social media hypothesispositive, negative, null, or the direction of association cannot be determined?4. In a sentence or two, please explain your reasoning for your answer in c.5. What is the null hypothesis for the hypothesis regarding TV viewing and civic engagement? the sequence of part of an mrna transcript is 5augcccaacagcaagaguggugcccugucgaaggag3 what is the sequence of the dna coding strand? how are the shapes alikei need to know When performing a nutrition assessment, the practitioner should include what information as part of the patient's food and nutrition history? Using the article "You Trouble" discuss whether or not stunt videos cause teens to take risks and increase impulsive behavior consider the given state of stress. take a = 21 mpa and b = 45 mpa. determine the principal planes. the principal planes are at and .Determine the principal planes using Mohr's circle. a) The principal planes are at and .Determine the principal stresses using Mohr's circle. b)The minimum principal stress is MPa, and the maximum principal stress is MPa.Determine the orientation of the planes of maximum in-plane shearing stress using Mohr's circle. c) The orientation of the plane of maximum in-plane shearing stress in the first quadrant is . The orientation of the plane of maximum in-plane shearing stress in the second quadrant is .Determine the maximum in-plane shearing stress using Mohr's circle. d) The maximum in-plane shearing stress is MPa.Determine the normal stress using Mohr's circle. e)The normal stress is MPa.