What does “a regulated militia” mean

Answers

Answer 1
well regulated Militia, being necessary to the security of a free State, the right of the people to keep and bear Arms, shall not be infringed." Such language has created considerable debate regarding the Amendment's intended scope.

Related Questions

Identifying Hard - to -Find subjects

1.Do you know the phone number of the restaurant?

2.Has your teacher asked yoh to turn in your report?

3.There is the new principal.

4.Here are the documents you asked for.

5.How were the pyramids built?​

Answers

Answer:

5 would be a hard question since you can just search it up and get the exact right answer unlike the other quetions where you ether search it or complate he task

Explanation:

Write a essay on my hobby at least 300 words ​

Answers

Answer: Figure out what your hobby is, why you do it, when, and how you started it.

Explanation:

help me asap
which types of sentence does this belongs to
trina and hareen went to a bar in hollywood to celebrate there anniversary

Answers

Answer:

Trina and Hareem went to a bar in Hollywood to celebrate their anniversary. simple sentence

The area of a square garden is 2025 square meters. Find the cost of fencing
the garden at Rs 5 per meter.​

Answers

Answer:

Total cost = Rs. 10125

Explanation:

Given the following data;

Area of square garden = 2025 m²

Cost of fencing per meter = Rs. 5

To find the cost of fencing the whole garden;

Total cost = Area * cost

Substituting into the equation, we have;

Total cost = 2025*5

Total cost = Rs. 10125

Therefore, the cost of fencing

the garden at Rs. 5 per meter is Rs. 10125.

how do you relate the hunger games to the issue that are happening in the world today​

Answers

It’s chaotic I guess
There are many possible ways to go with this question.

1) Extreme poverty.
2) Autocratic leaders (North Korea, etc.)
3) Class divisions (rich vs. poor. an example of this is how billionaires grew richer during the pandemic.)

These are just a few I thought of but this is only the tip of the iceberg.

How does the author respond to the counterargument, "the enormous and expanding use of pesticides is necessary to maintain farm production"? Check all that apply. She states that overproduction, not maintaining production is the problem. She includes facts and statistics as evidence in support of her rebuttal. She plays on the audience's fear of food shortage to elicit an emotional response. She concedes that, in some states, farms need help battling insect attacks. She quotes a relevant, expert source on the topic.

Answers

Answer:

A,B,E

Explanation:

Answer:

A,B,E

Explanation:

Edge 2021

which best identifies when a story is narrated by one of its characters

Answers

Answer: Third person
Third person is when a story is narrated by one of the characters

"George Washington Carver was an artist long before he became a scientist" explains how
Please write an objective summary

Answers

Answer:

The first sentence is written in the passive voice, with a passive verb. George is the subject, so what is being done to him is the passive verb. The less passive form of the sentence would be similar to "Mrs. Millholland gave George Washington Carver piano lessons." This is the active verb, since it is being done/has been done by a person rather than a subject being acted on.

Explanation:

how does the point of view contribute to how the events are described in the passage of “THE WORST BIRTHDAY” FROM HARRY POTTER AND THE CHAMBER OF SECRETS

Answers

Answer:

Answer: The point of view contributes to how the events are described in the passage because in Harry Potter's point of view, his twelfth birthday was the worse.

Explanation:

For his twelfth birthday, Harry Potter had to stay upstairs in his room making absolutely no noise whatsoever and pretending he didn't exist. He couldn't even use Hedwig, his owl, to send messages to his friends Hermione and Ron because she was locked up by Uncle Vernon. In addition to this, he met Dobby, the house elf, who was on his bed. Dobby ruined Petunia's sumptuous pudding by making it crash to the ground. This (and the owl) causes the Masons, Uncle Vernon's guests, to leave the house. Point of view contributes to these events because in Harry's opinion, being stuck in his room with no form of communication is the worst way to spend his birthday. He thinks he should be spending it by going out with his friends or socializing.

Explanation:

Match the multimedia presentation elements with their descriptions.
video
audio
text

Answers

Answer:

Video and Audio

Explanation:

Find the main idea of this text


Manson still wasn't connected to the Tate-LaBianca murders until family member Susan Atkins, who'd confessed to being connected to the Hinman murder, told other women in jail that she was involved in the two massacres. Suddenly, the evidence started to make more sense. All of the family members who'd participated in the murders were already in jail — it was simply a matter of building the case against them.​

Answers

Answer:

A crime

Explanation:

As you can tell the whole story or paragraph talks about a murder

Another dog could do about one hundred and fifty things
is this a compound sentence

Answers

yes!!!!!!! it has an "and"

Answer:

yes

Explanation:

Which phrase is the best way to define tone?

the reader’s attitude toward a topic

the reader’s experience with the topic

the author’s attitude toward the topic

the author’s experience with the topic

Answers

The author’s attitude toward the topic is the phrase is the best way to define tone. Hence, option C is correct.

What is meant by author’s attitude?

The tone or attitude of a writer reveals to the reader their feelings towards the subject they are writing about. An author's tone can be determined by their use of metaphorical language, sentence structure, and diction, as well as by the details, arguments, and supporting evidence.

An author's tone is usually described using adjectives like cynical, melancholic, empathic, cheerful, indignant, positive, angry, sarcastic, prayerful, sardonic, serious, spiteful, intense, and excited.

Tone words are particular phrases that assist a writer in expressing their attitude toward the subject. A word's overall connotation might be positive, negative, or neutral.

Thus, option C is correct.

For more details about author’s attitude, click here:

https://brainly.com/question/14730348

#SPJ2

The function of the thesis statement of an essay is to
Ograb the attention of readers with a quote.
list specific details and facts to prove them.
Oprovide readers with the main idea of the essay.
wrap up an essay with a good summary.


(this is critical thinking please help)

Answers

Answer:

provide readers with the main idea of the essay

As a student, which vocational crafts,
would you like to learn? Why? (example -
pottery, carpentry, tailoring, gardening, etc.
Students can name any vocational craft

Answers

Answer:

Pottery to be able to make my own designs, create unusual designs

Help 2x + 3x+7y+= ?



Free memes if you are still awake. Btw I put question on top so I don’t get reported.

Answers

Answer:

=5x+7y

Explanation:

Let's simplify step-by-step.

2x+3x+7y

Combine Like Terms:

=2x+3x+7y

=(2x+3x)+(7y)

=5x+7y

Answer:

Heya!

Soo funny pictures!

Explanation:

Well, You can find the answer in Gôôgle..

And also try our Indian server, you get answers very soon to any type of questions.

A novel that begins with a scene describing an action-packed sword fight is
most likely going to be a(n)
A. adventure story
B. picture book
C. comedy
D. biography

Answers

Answer:A

Explanation:

Read the excerpt from “How I Learned English.”

I fell back,
Dazed, clutching my brow,
Groaning, “Oh my shin, oh my shin,”
And everybody peeled away from me
And dropped from laughter, and there we were,
All of us writhing on the ground for one reason
Or another.

Readers can tell that this is the climax of the poem, because it

gives information about what the speaker thinks and feels.
adds to the idea that the speaker feels like an outsider.
changes the speaker’s struggle to fit in with the other boys.
shows how the speaker’s problems with the boys are solved.

Answers

Answer:

I think its D

Explanation:

Answer:

The correct answer is C

Explanation:

Because I said so

Explain how Martin Luther King, Jr. is being honored in Africa.

Answers

Answer: Because there black and martin luther king is great

Explanation:

Answer:

The act of Martin Luther King Jr. in America influenced other countries too.

It used to be that courting was the way two people got married. Parents would arrange a courtship when their children were young, and both families knew that the children would get married in the future. The families stayed close, and the children respected their parents' wishes. But today, families have nothing to do with the process of marriage. For example, any two people can go on a date, and at the end of the date, decide if they want to date again. They may or may not get married, and very few check with their parents to see what they think.
A. courtship is a good way to get married
B. dating doesn't involve family
C. families used to have a more important role in marriage
D. dating might lead to marriage ​

Answers

Answer:

c

Explanation:

it explains the reason of the paragraph

Answer:

c

Explanation:

but sometimes when we love someone they cant allow us to marry that person. so its a conflicting view.

Locate the errors in the passage below. At which stage in the writing process
should a writer target them?
When you turn in a paper, you hpe it wll be free of errors.
Howevr, if yu don't chek it over carefully, you will find your
hope is not well founded. You might even be unpleasantly
surprised by your grade.
A. Drafting
B. Prewriting
C. Outlining
D. Revision

Answers

Answer: D

Explanation: you might want to check your paper and Revise it.

Answer:

D. revision

Explanation:

revision is the stage in the writing process in which a writer reviews their piece and checks for any errors or inconsistencies. revision comes after drafting, rewriting, and outlining. it is after the piece has been written.

i hope this helps! have a nice day <3

in your own words describe how anne felt about green gables

Answers

Answer:

Anne felt highly grateful and interested in Green Gables, and wanted to explore and meet new people. (This depends on what part.)

Explanation:

Use your understanding of key ideas, organizational structure, and point of view to explain how Knox's "Introduction to Antigone" might enhance your reading of the library excerpt from the play, Antigone.

Answers

Answer and Explanation:

"Introduction to Antigone" presents a text where the characters of the play are humanized, showing strands of goodness and evil, which make the reader better understand everyone's actions and the motivations behind everything they do, especially Creonte and Antigone. This allows the reader to read the original text of the play with a more comprehensive and complete view of the characters, judging their depths and better understanding the entire plot. In addition, the reader is able to reduce possible bias and caricature interpretations about the play.

Stalactites and stalagmites are

A) The opposite of cave formation

B) another term for cavern walls

C) caused by cave formation

D) types of cave formation

Answers

Answer:

D

Explanation:

The dodo bird used to roam in large flocks across America.However, the dodo wasn't startled by gun shot. Because of this, frontiersmen would kill entire flocks in one sitting.Unable to sustains these attacks, the dodo was hunted to extinction.

Which type of structures on the last example can represent?

A.Chronological.

B.Cause and Effect.

C.Compare and Contrast.

D.Problem and Solution.

E.Sequence / Process.

F.Spartial / Descriptive​​​​​

Answers

B. Cause and effect hope this helps!

Read this sentence from the main text:

While we figure out how to do that, feel free to let your dog lic k your face. Rover's microbes may just be saving your life one day.

What purpose do these sentences serve? (7 points)

To create awareness of how microbes affect all mammals
To increase compassion for all forms of life including microbes
To restate the main point and suggest microbes are all around us
To suggest we should avoid most microbes in our world

Answers

Answer: C) To restate the main point and suggest microbes are all around us.

Explanation: I took the test! hope this helps.

Answer:

I need this to will put answer when i get it

Explanation:

What would you do if you were god for a day?

Answers

Answer:

If I were god for a day I would question myself why is life going the way it is or I would make the planet a better place. That's what I would do.

Does this help?

How does walter represent the ABCs at the end of the film?

Answers

Answer:

At the beginning of the film, Walter Mitty shows the ABCs through his imagination. Only through his imaginary self, Mitty personifies a dominant male character, who is not afraid of facing danger. For instance, while on the phone with Todd, Mitty imagined he saved people from a building about to explode. In his imagination, he jumped from the train station to the building, through a window, and evacuated everyone. Another example was where he confronted his cruel boss, contrary to his real-lifesubmissive character. He fought him in the elevator and was not afraid to stand up to his boss, no matter the consequences. The last example of Mitty showing the ABCs was when he imagined himselfin a relationship with Cheryl Melhoff. He pretended to impress her in his imagination

Explanation:

happy to help ya :)

I WILL GIVE THE BEST ANSWER BRAINLIEST!!
Explain a problem you think needs to be solved. How would you solve it?


Base your response on your own observations and experiences and research as needed. In your response:


- define the problem;

- explain the importance of solving it; and

- propose a specific solution persuasively.

Your post should be two or more paragraphs

Answers

Answer:

Hunger and Malnutrition in Africa

Explanation:

A problem I think that needs to be solved is hunger and malnutrition of anyone. I would solve this problem by bringing it up to people who are high in government.

The problem is not only in our country but in other countries like Africa. Young children and adults are starving. We know this is a problem and people have tried to solve it but there's no final solution. These people are humans too, so as you are sitting at home enjoying a full course meal, children in Africa are only eating one meal a day. That extra candy bar you had today, could have given a child in another country a whole day of food or even maybe a week of food.

How can we solve this problem finally though? We all can help! We can bring up this issue to our government. If you were in Africa with only one meal a day, you would want people trying to help you! Why can't our government try to help more in situations like these? The first step to solving this is research, and getting the attention of people who are higher in government.  Africa has been starving since 1980! And even before that specific year. Why should we wait another 5 years or 20 years to change, and help other humans out? We should all change now!

you're welcome :)

PLEASE can someone find a quote from Educated by Tara Westover with a page number or general chapter that used an allusion, alliteration, or repetition. I will give brainlyist it if you seriously answer!!!!

Answers

Answer: “You can love someone and still choose to say goodbye to them,” she says now. “You can miss a person every day, and still be glad that they are no longer in your life.”

“The thing about having a mental breakdown is that no matter how obvious it is that you're having one, it is somehow not obvious to you. I'm fine, you think. So what if I watched TV for twenty-four straight hours yesterday. I'm not falling apart. I'm just lazy. Why it's better to think yourself lazy than think yourself in distress, I'm not sure. But it was better. More than better: it was vital.”

“It’s strange how you give the people you love so much power over you.”

“I began to experience the most powerful advantage of money: the ability to think of things besides money.”

“To admit uncertainty is to admit to weakness, to powerlessness, and to believe in yourself despite both. It is a frailty, but in this frailty there is a strength: the conviction to live in your own mind, and not in someone else’s.”

“Curiosity is a luxury for the financially secure.”

Explanation:

Other Questions
Which of the following best describes the purpose of the White Wolf movement in China?A peasant uprising meant to rid the countryside of Christian missionariesA communist party initiative to radicalize peasantsChiang Kai-shek's plan to instill moral purpose and discipline in the Chinese publicA peasant-supported band of armed men who robbed the rich to give to the poor to restore justice sherrington concluded that the cortex had an inhibitory effect on reflexes because 14. (05.07 LC)In this segment, you learned that writers changeelements of a play (setting, characters, theme,dialogue) when creating modern adaptations.Choose one play element and write two to threecomplete sentences to explain how it might bechanged. (10 points) the stringbuilder class's insert method allows you to insert a(n) ________ into the calling object's string. Using your knowledge of historical context, which lines illustrate what happened to Yuba City afterthe gold rush?- Alas, that beauty thus should fade, / Or live so unregarded!- The Feather River at thy feet,/ The lofty Buttes behind thee.- I've seen her at the morning prime-/The sky looked sweeter, bluer!- What has she said, or done, to be / Thus doomed, and thus deserted? all of the following are popular architectures for master data management except: group of answer choices identity registry. integration hub. persistent. normalization. some employees who do not take advantage of work-life balance options resent their coworkers who are more likely to use work-life programs T/F Two identical spaceships are moving through space both with speed v0. both spaceships experience a net force of magnitude f0 over the same time interval. for spaceship 1, the net force acts in the same direction as the spaceship is moving; for spaceship 2, the net force is directed opposite to the spaceships motion, causing spaceship 2 to slow down but not stop. for which spaceship, if either, does the kinetic energy change by a greater magnitude, and why? Compute an expression for P{,m max B(s) 41 x} 7. Let M = {maxx, x}. Condition on X(t1) to obtain P(M) = PMXt) = y) 1 V2f, y? According to JP Morgan, the following factors determine your risk tolerance: your time horizon, your goals, & your 'risk appetite'.TrueFalse melvin borrowed $1,200 for furniture. his monthly payments were $60 for 24 the total amount repaid.A. $240B. $1,200C. $1,440D. $2,880 Write an E20 assembly language program that will store the value 1099 at memory cell 456, then halt. Make sure that your program is correct and can be assembled. Who owned American land first URGENT!!!!!! Think about a situation of division that would benefit from increased unityPlease give me a few different options to choose from. Thank you! write a statement that opens a file customers.dat as a random access file for both reading and writing. the created object should be fstream. part 1: let x and y be two independent random variables with iden- tical geometric distributions. find the convolution of their marginal distributions. what are you really looking for here?1 Costco buys a Euro put option (contract size: 125,000) at a premium of $0.13/. The exercise price is $1.18/: If the spot at expiration is $1.08/, what is the Costco's profit? $3,750 loss O $16,250 loss O $12,500 loss $28,750 loss The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right.I. Which end of the DNA template is 5 and which end is 3?II. Give the sequence and identify the 5 and 3 ends of the RNA transcribed from this template. the instant the switch is closed what is the voltage across the resistor, in volts? rl switch circuit select one: a. 0 b. 20 c. 40 d. 2 A sandwich shop owner has the following information: P = MR = $4, ATC = $2, AVC = $1, MC = 4, and Q = 500. From this, she can determine: a. she has earned economic profits of $1,500. b. she has earned economic profits of $1,000. c. she has earned zero economic profits. d. her profits are not being maximized.