Which class of enzyme attaches phosphate groups to other molecules ?

Answers

Answer 1

The correct answer is a kinase. Kinases are enzymes that couple the hydrolysis of ATP to the addition of a phosphate group to its substrate.

The kinase is an enzyme that attaches a phosphate group to a protein. A phosphatase is an enzyme that removes a phosphate group from a protein. Together, these two families of enzymes act to modulate the conditioning of the proteins in a cell, frequently in response to externalstimuli.A type of enzyme( a protein that speeds up chemical responses in the body) that adds chemicals called phosphates to other motes, similar as sugars or proteins. This may beget other motes in the cell to come either active or inactive.

Kinases are a part of numerous cellprocesses.Protein kinases and phosphatases are enzymes catalysing the transfer of phosphate between their substrates. A protein kinase catalyses the transfer of γ- phosphate from ATP( or GTP) to its protein substrates while a protein phosphatase catalyses the transfer of the phosphate from a phosphoprotein to a water patch.

Read more about protein;

https://brainly.com/question/884935

#SPJ4


Related Questions

Humans infected with Brucella species develop ________ characterized by fever, chills, sweating, muscle aches, and headache.

Answers

According to the research, humans infected with Brucella species develop brucellosis characterized by fever, muscle aches, and headache.

What is brucellosis?

It is a bacterial and infectious disease caused by bacteria of the brucella genus whose reservoir of this bacterium are animals and, mainly, cows, sheep, goats and pigs.

The most frequent is the appearance of general symptoms, among which fever, chills, muscle aches, among others, predominate.

Therefore, we can conclude that according to the research, humans infected with Brucella species develop brucellosis characterized by fever, muscle aches, and headache.

Learn more about brucellosis here: https://brainly.com/question/13086367

#SPJ1

A group of biology students test the growth of bacteria under different conditions. the students apply the same amount of bacteria to identical petri dishes enriched with nutrients, then place each plate at a different temperature. the bacteria are allowed to grow for three days after which the number of bacterial colonies on each plate is counted. what is the dependent variable in this experiment?

Answers

I will leave your question unanswered. Thanks for the points I stole from you!

deja lo checo y te ayudo

Explanation:

después te ayudo

What are small area variations? a. geographic variations in health care practice b. demographic variations in health care practice c. both a and b d. neither a nor b

Answers

Small area variations are geographic variations in health care practice. That is option A.

What are geographic variations?

In the health sector, geographic variations are a type of variations that involves the observation of small area using population-based medical services across the relatively small geographic areas.

The importance of geographic variations in health care practice include the following:

It helps in monitoring disease outbreaks,

It targets public health strategies towards a particular disease.

It saves cost for health care delivery services

It makes health care delivery services available for the populace.

Learn more about variations here:

https://brainly.com/question/17313169

#SPJ1

Red-green colorblindness is an X-linked recessive trait in humans. A colorblind woman and a man with normal vision have a son. What is the probability that the son is colorblind

Answers

There is a 50%  probability that the son is red-green colorblind and 50% chance that the sons do not have the gene and will be healthy. There is a 50% chance that a son will inherit the gene and show the trait or disorder.

Red-green colorblindness is an X-linked recessive trait in humans and in this a person cannot distinguish between red and green color but their eye sight is normal. However, males are affected more than females, because the gene is present on the X chromosome. So there is a 50% chance that the son is colorblind. Males are affected more  than females because the gene is located on the X chromosome.

Learn more about Red-green colorblindness on:

https://brainly.com/question/13021754

#SPJ4

Paleontologists organize fossils of related species based on their __________________ similarities

Answers

Paleontologists organize fossils of related species based on their physical similarities.

Paleontologists discover and examine the remains of extinct organisms to learn about evolution.Any remnant of ancient life preserved in a geologic setting is referred to as a fossil or paleontological resource.

Fossils provide a direct link to the lifestyles, environments, and climatic conditions of the past. They reveal how life, the environment, and the climate have evolved over time and how living things have reacted to those changes. These teachings are especially crucial now that the modern climate is changing more and more.

To learn more about paleontologists click here

brainly.com/question/12048781

#SPJ4

A particle that is 1.0 mm in diameter traveling in a stream at 100mm/s
a transport
b settle
c erode
d deposit

Answers

A.  A particle that is 1.0 mm in diameter traveling in a stream at 100mm/s is being transported.

Transportation of particles by stream

The transportation of particles by stream is movement of  particle of certain size by the force of the stream.

Transportation of particles can occur by saltation and by traction .

A particle that is 1 mm in diameter can easily be transported by a stream moving at 100 mm/s.

Thus, a particle that is 1.0 mm in diameter traveling in a stream at 100mm/s is being transported.

Learn more about particle transportation here: https://brainly.com/question/21287562

#SPJ1

Answer:

b. settle

Explanation:

True or false: sensitivity differences during light and dark adaptation result, at least in part, from the difference in bleaching and regeneration rates of photopsin and rhodopsin.

Answers

True, photopsin and rhodopsin are the photoreceptor proteins found in the cones of the retina and are the basis of color vision.

What is the function of rhodopsin?

The retina contains a chemical compound called rhodopsin. It is responsible for converting light into electrical impulses that the brain interprets as vision. Nerve fibers from the retina come together at the back of the eye and form the optic nerve, which carries electrical impulses to the brain.

What is the function of the retina?

The function of the Retina is to capture light through the cornea, pupil and lens, and, through the optic nerve, convert it into neural signals and send them to the brain, which transforms it into visual recognition.

With this information, we can conclude that A very thin layer of light-sensitive tissue, located at the back of the eye, the retina is formed by millions of photoreceptor cells, which capture, record, decode light waves and, through the optic nerve, send them to the brain, where the vision.

Learn more about rhodopsin in brainly.com/question/3648231

#SPJ1

Do you think microwave ovens, electromagnetic fields, and ultrasound, as energy transmitters, would induce cellular injury?

Answers

No these do not emit ionizing radiation and would have a low likelihood of resulting in cellular injury.

Are microwaves harmful electromagnetic waves?

Non-ionizing radiation includes radio waves, microwaves, and visible light. UV light is the only non-ionizing radiation that can cause cancer. In conclusion, microwaves are safe to use and do not harm human health in any way, including the development of cancer. In order to heat the water in meals, microwave ovens use electromagnetic waves at a frequency of 2.45 GHz.

Injuries caused by hot containers, overheated food, or exploding liquids account for the majority of microwave-related injuries. Most injuries are not caused by radiation. Microwave radiation has been linked to numerous negative effects on the central nervous system, including sleep difficulties, learning disabilities, and memory loss, according to a significant body of research.

Learn more about microwaves here:

https://brainly.com/question/1304742

#SPJ1

A neurotransmitter binds to a metabotropic receptor and pka is ultimately activated, which type of neurotransmitter likely bound?

Answers

A Final statement or concluding statement

Adrenergic neurotransmitter is likely to bound.

What neurotransmitter activates adrenergic receptors?

The neurotransmitter norepinephrine (NE) is released by adrenergic nerves and binds to specific receptors in the target tissue to produce physiological responses. The binding of neurotransmitters to receptors activates signal transduction pathways, resulting in the observed changes in cardiac function.

Adrenergic receptors (adrenoceptors) are receptors that bind adrenergic agonists consisting of the sympathetic neurotransmitter NE and the circulating hormone epinephrine (EPI). The maximum essential adrenoceptor withinside the coronary heart is the β1-adrenoceptor. When activated via way of means of a β1-agonist consisting of NE or EPI, coronary heart charge is elevated conduction pace is elevated contractility is elevated, and the charge of myocyte rest is elevated.

To learn more about Neurotransmitters from the given link

https://brainly.com/question/840056

#SPJ4

The innate ability of cells to self-destruct is a part of physiological processes known as Group of answer choices the unified theory of aging. a free radical response. programmed cell death. the coenzyme restriction model.

Answers

The innate ability of cells to self-destruct is a part of a physiological process known as programmed cell death.

Programmed cell death (PCD) is the destruction of a cell caused by intracellular processes, such as apoptosis or autophagy. PCD is carried out through a biological mechanism, which often confers advantage during the lifecycle of an organism. For instance, the differentiating of fingers and toes in a growing human embryo is caused by the apoptosis of cells between the fingers, resulting in the separation of the digits. PCD fulfils key tasks during the development of plant and animal tissues. Necrosis is the death of a cell triggered by external forces, such as trauma or infection, and it manifests in various ways.

Learn more about programmed cell death here :

https://brainly.com/question/14263310

#SPJ4

i need help with this in bio

Answers

Answer:B

Explanation:Codominance, as it relates to genetics, refers to a type of inheritance in which two versions of the same gene are expressed separately to yield different traits in an individual.

Yesl
M m m mjddfsgsgss

A lateral cervical vertebral projection demonstrating the right and left articular pillars and zygapophyseal joints with superoinferior separation, the inferior cortices of the cranium and mandible without superimposition, and the vertebral foramen of C1 visualized was obtained with the:

Answers

The said lateral cervical vertebral projection was obtained with the head and upper cervical vertebrae tilted toward the IR.

What are the parts of cervical vertebrae?The cervical vertebrae serve as the origination and insertion points for muscles that support and enable movement of the head and neck.The cervical spine has 7 stacked bones called vertebrae, labeled C1 through C7. The top of the cervical spine connects to the skull, and the bottom connects to the upper back at about shoulder level. The superior and inferior articular processes of cervical vertebrae have fused on either or both sides to form articular pillars.A lateral cervical projection with accurate positioning is as follows: C1 & C2 without cranial or mandibular superimposition, open intervertebral disk spaces, superimposed right & left articular pillars & zygapophyseal joints, the spinous process in profile.

Learn more about cervical vertebrae here:

https://brainly.com/question/20840479

#SPJ4

Because extremophiles are hard to culture outside of their native environments, how do scientists classify and identify specific species?.

Answers

They use DNA sequencing to identify species via genetic differences.

What is the significance of DNA sequencing?

The four chemical "bases" that make up the DNA molecule must be identified in the correct order in order to sequence DNA. The sequence provides information to scientists about the type of genetic data that is contained in a certain DNA segment.

For instance, scientists can utilize sequence data to identify the DNA segments that contain genes and the segments that carry regulatory instructions that switch genes on and off. Furthermore, and this is crucial, sequencing data might point out variations in a gene that might be harmful.

Large DNA lengths, 1 million bases or more, from various individuals can now be compared swiftly and affordably by researchers. Such comparisons can reveal a wealth of information regarding how inheritance affects illness susceptibility and how the body reacts to environmental factors. The potential for diagnostics and treatments is also greatly increased by the faster and more affordable genome sequencing.

The biology of development and evolution can also be better understood by comparing the genomic sequences of other animals and species, like yeast and chimpanzees.

Learn more about DNA sequencing here:

https://brainly.com/question/13867031

#SPJ4

The enteric division of the ans is found in the __________ of the body

Answers

The enteric division of the ANS is found in the gastrointestinal tract of the body.

Here ANS stands for the autonomic nervous system which can be described as a collection of motor neurons that regulates involuntary physiologic processes including heart rate, blood pressure, respiration, digestion, and sexual arousal.

It has three divisions: sympathetic, parasympathetic, and enteric.

Out of three, the enteric division has two plexuses: the myenteric (Auerbach) which is usually detected in the GI tract, and the submucosal (Meissner) which is usually observed in the submucosa.

The sympathetic division is located in intermediolateral columns, or lateral horns, of the spinal cord whereas the parasympathetic division is located in the head.

Learn more about Autonomic Nervous System here

brainly.com/question/11097861

#SPJ4

Other things being equal, what is a potential disadvantage of an enzyme having a very high affinity for its substrate?.

Answers

An enzyme with a high affinity for its substrate will require more energy to generate an enzyme-transition state complex (the activation energy of the forward reaction) because the energy of the enzyme-substrate complex will be reduced.

What is the disadvantage of an enzyme having high affinity fir its substrate?

Since the ES complex would be in a "energy trough," the activation energy for the transition state would be quite high.

Tight enzyme-substrate binding will lower the reaction's forward rate constant.A forward reaction's activation energy will increase when an enzyme's affinity for its substrate is high.Because the enzyme-substrate complex will be located in a deep energy well, it will be more stable.

In contrast to the situation where the substrate-enzyme binding is weaker, a tight binding of the substrate to the enzyme will alter the amounts of free substrate and free enzyme. This little modification won't have much of an impact on the reaction kinetics because the substrate concentration is often higher than the enzyme concentration.

It is unlikely that tight binding would result in the active site being altered. Since the enzyme is significantly bigger than the substrate, it is unlikely that it will change shape.

The reaction's forward rate constant will decrease with tight enzyme-substrate binding. It is conceivable that a substrate that is securely bonded would not easily change its shape as it passes from the transition state to the products.

High enzyme substrate affinities will result in a decrease in the energy of the enzyme-substrate complex and an increase in the energy needed to generate the enzyme-transition state complex (the activation energy of the forward reaction).

Learn more about enzyme affinity here:

https://brainly.com/question/24261115

#SPJ4

Match the organism to the infection: Group of answer choices Streptococcus pyogenes [ Choose ] Varicella zoster [ Choose ] Papillomavirus [ Choose ] Enterococcus faecium [ Choose ] Borrelia burgdorferi [ Choose ] Bordetella pertussis

Answers

S. pyogenes causes Strep throat, Varicella zoster causes varicella, Papillomavirus causes HPV, E. faecium cause urinary tract infection B. burgdorferi causes Lyme disease and B. pertussis causes Pertussis.

What is Bordetella pertussis?

Bordetella pertussis is a  bacteria from the genus Bordetella that causes a respiratory disease known as Pertussis.

Moreover, Bordetella burgdorferi is another bacteria from genus Bordetella that causes Lyme disease, an illness whose symptoms include fever and fatigue.

In conclusion, Streptococcus pyogenes causes Strep throat, Varicella zoster causes varicella, Papillomavirus causes HPV, Enterococcus faecium cause urinary tract infection Borrelia burgdorferi causes Lyme disease and Bordetella pertussis causes Pertussis.

Learn more about Lyme disease here:

https://brainly.com/question/12185102

#SPJ1

The bone marrow begins producing cells in the _____________ month of fetal life.

Answers

The bone marrow begins producing cells in the fourth month of fetal life.

Hematopoiesis establishes in the marrow and grows there until, at term. This process starts in the late first trimester when the bones are large enough to contain marrow cavities. Hematopoiesis can move outside of the bone marrow  to various organs under conditions of prenatal and neonatal stress.

Between the bone spicules are the hematopoietic components. Both sinusoids and a robust circulatory network are present in the marrow. Pluripotent stem cells are the progenitor cells that give rise to all hematopoietic components and lymphoid cells.

To learn more about bone marrow click here

brainly.com/question/819753

#SPJ4

The type of bacteria that rarely shows any active motility is known as _____.
a. pus
b. cocci
c. flagellum
d. spirilla

Answers

Cocci bacteria are rarely motile.

Coccus or cocci bacteria are round or sphere-shaped bacteria. They lack flagella or any locomotive organ so they are non-motile.

Cocci contain multiple genera like Streptococcus, Staphylococcus, Enterococcus and Diplococcus. They are divided based on the pattern they grow. For instance, Diplococcus always appears as joined two cells implying a pair of cells.

They can also be both gram-positive bacteria (eg. Neisseria spp.) and gram-negative bacteria (eg. Streptococcus spp.).

They can show pathogenicity, symbiotic and commensalism. Some of the pathogenic cocci bacteria are Streptococcus, Staphylococcus and Pneumococcus which can cause throat infection, food poisoning and pneumonia respectively.

Learn more about Cocci bacteria on

https://brainly.com/question/14467443

#SPJ1

Each cell in an individual's body carries certain molecules that tell the body they belong to that individual. those molecules are called ________.

Answers

Answer:

MHC Markers

Explanation:

The function of MHC molecules is to display peptide fragments derived from pathogens on the cell surface for recognition by the appropriate T cells.

What feature would easily distinguish schist and gneiss from quartzite and marble?

Answers

Foliation is much better developed in most schists and gneiss than in most quartzites and marbles.

The major contrast between schist and gneiss is that schist is made of mudstone or shale, whereas gneiss is made of micas, chlorite, or other platy minerals. While Marble and quartzite the major difference is that marble is composed of calcite whereas quartzite is composed of quartz.

Schist is identified by its flat and large sheet-like grains it also has flat and elongated minerals such as talc or micas. Gneiss is a metamorphic rock formed by changing schist, granite, or volcanic rocks through intense heat and pressure. Gneiss is foliated, which means that it has layers of lighter and darker minerals.

To learn more about schists and gneiss ,here

https://brainly.com/question/984436

#SPJ4

Mycobacteria have a large amount of a component in their cell wall that other bacteria lack. that component is:_______

Answers

Mycobacteria have a large amount of a component in their cell wall that other bacteria lack and this component is lipids.

What are Mycobacteria?

Mycobacteria are a special class of bacteria belonging to the family Mycobacteriaceae (Actinomycetota).

These bacteria (Mycobacteria) are characterized to be a cell wall composed of mycolyl-arabinogalactan-peptidoglycans.

In conclusion, Mycobacteria have a large amount of a component in their cell wall that other bacteria lack and this component is lipids.

Learn more about Mycobacteria here:

https://brainly.com/question/15726818

#SPJ1

What evidence was provided for localized functions inherent to specific anatomical brain structures during execution of behavior and mental processes?

Answers

The fMRI is now the most commonly used method of learning about brain structure.

Functional magnetic resonance imaging (fMRI) is a type of brain scan that uses a magnetic field to create images of brain activity in each brain area.

The fMRI detects the amount of blood flow in each brain region, and thus is an indicator of neural activity. Very clear and detailed pictures of brain structures can be produced via fMRI.

The advantage of the fMRI is that it is noninvasive, fMRIs are substantial and they are now available in many university and hospital settings. The fMRI is now the most commonly used method of learning about brain structure.

Our words are bound by an invisible grammar which is embedded in the brain.

  -Jonah Lehrer, in Proust Was a Neuroscientist.

To learn more about Functional magnetic resonance imaging (fMRI) here

https://brainly.com/question/12078873

#SPJ4

Sexual reproduction produces ______, while asexual reproduction produces ______.

Answers

Answer:

Sexual reproduction produces genetically different offspring from two parents while asexual reproduction produces genetically identical offspring from one parent.

Sexual reproduction will see to the offspring taking half of their genetics from the father (male), while the other half comes from the mother (female). The offspring would further inherit based on whether the traits are dominant or recessive. However, in asexual reproduction, there is only one parent, so all the traits are passed down.

Learn more about sexual and asexual reproduction, here:

https://brainly.com/question/2436789?referrer=searchResults - Difference between sexual vs asexual reproduction.

In order to prevent accidental needle stick injury and potential exposure to infectious agents, what should you do with needles and needle-containing devices?

Answers

In order to prevent accidental needle stick injury and potential exposure to infectious agents, some preventive measures should be taken like use of alternatives, proper disposal of used needles, proper management, avoid spills, take common precautions, participate in education programme etc.

Preventive measures are:

1) When safe and efficient alternatives are available, avoid using needles.

2) Recapping or bending needles that could be infected is not advised.

3) Bring sharps containers with standard labels that are impervious to leaks and punctures to clients' houses. Don't assume there will be any such containers. Sharps and used needles that could be contaminated should be promptly disposed of in the containers.

4) Before using, make a plan for the proper management and disposal of needles.

5) Containers for sharps should be kept out of children's, pets', and other people's reach.

6) Transport used sharps containers securely to avoid spills.

7) Consistently observe common precautions, infection prevention, and hygiene standards.

8) Participate in the bloodborne pathogens education programme offered by your workplace.

Hence, In order to prevent accidental needle stick injury and potential exposure to infectious agents, these preventive measures should be taken.

Learn more about Needle stick safety here

https://brainly.com/question/10314987

#SPJ1

What is the stage of cell division in a diploid organism if you see seven chromosomes, each consisting of a pair of sister chromatids

Answers

Answer:

Metaphase is the stage of cell division in a diploid organism if we see seven chromosomes, each consisting of a pair of sister chromatids.

Hope its helpful!

Meiosis II prophase is the stage of cell division in a diploid organism, each consisting of a pair of sister chromatids

There are four crucial processes that take place during prophase II of meiosis II. These include chromatin condensation into chromosomes, thinning of the nuclear envelope, centrosome movement to either pole and re-building of the spindle apparatus. Centrosomes do not exist in every cell, though.

Both of the daughter cells that were created during meiosis I go through meiosis II. The process of cell division starts right away because DNA replication does not occur during this second meiotic stage. Prophase II sets up the cell for meiosis II, which results in the production of four haploid cells, each of which has half the genetic material that was previously present in the original, duplicated diploid cell.

To learn more about Meiosis II  please visit-
https://brainly.com/question/772396
#SPJ4

A toxicity of folate can disguise a deficiency of which nutrient, resulting in nerve damage?

Answers

Large dose of folate increase the symptom of vitamin B12 deficiency . the vitamin B12 deficiency can lead to permanent damage of the spinal cord nerves and brain.

It can cause severe birth defects which is called neural tube defects. this defects include spinal, pifida . folate deficiency can also increase your chance of placental abrupt ion is a condition in which placental separate from uterus.

High dose of folate typically be remedied by taking supplement of both folic acid and vitamin B12. vitamin B12 works closely with vitamin B9 also called folic and folate acid which is help to make red blood cells and iron work better in our body.

To learn more about folate here

https://brainly.com/question/16040966

#SPJ4

If the planet was attacked by a disease that caused people to lose the use of their frontal lobes, one way people might be affected is they may

Answers

If the planet was attacked by a disease that caused people to lose the use of their frontal lobes, one way people might be affected is they may lose their self awareness.

What is Brain?

This is an organ which is located in the head region and comprises of rich network of neurons which are enclosed in the cranium. It serves as the control center of the central nervous system and has different types of lobes such as frontal etc with unique functions.

The frontal lobe is located in the anterior part of the brain and is responsible for different types of voluntary movements and cognitive functions such as interaction, self awareness etc.

This is therefore the reason why frontal lobe was chosen as the most appropriate choice.

Read more about Frontal lobe here https://brainly.com/question/3031921

#SPJ1

Identify each of the cell types listed that are associated with the alveoli of the lungs.

Answers

The cell types that are associated with the alveoli of the lungs are Type 1 pneumocytes, Type 2 pneumocytes and Alveolar macrophages.

Which type of cells present in alveolus?

Each alveolus has three types of cell i.e. Type 1 pneumocytes, Type 2 pneumocytes and macrophages. These cells perform function of respiration in the lungs.

So we can conclude that the cell types that are associated with the alveoli of the lungs are Type 1 pneumocytes, Type 2 pneumocytes and Alveolar macrophages.

Learn more about alveoli here: https://brainly.com/question/11720309

#SPJ1

in meiosis prophase 1 why excahnge of genetic information is important?

Answers

The exchange of genetic information leads to genetic diversity.

What is genetic diversity?

It refers to the number of unique genes present in the genome of organisms.

The more the number of unique genes an organism has, the more the chances of surviving unfavorable changes to the environment.

Crossing over, the exchange of genes, increases the number of unique genes that a cell will have. Thus, it helps increase genetic diversity and chances of survival in the environment.

More on crossing over can be found here: https://brainly.com/question/19671756

#SPJ1

___occurs as the earth comes out of an ice age.
o a. magnetic deviation
o b. polar deviation
o c. global warming
o d. global cooling

Answers

C:global warming …….
Other Questions
In ____________________ connections, your computer dials up and connects to your ISP's computer only when needed.A. AepanetB. BroadbandC. Dial-upD. Bandwidth cheng is making a trip to her safe deposit box. what is she most likely planning to do?group of answer choices suppose the population of bears in a national park grows according to the logistic differentialdp/dt = 5P - 0.002P^2where P is the number of bears at time r in years. If P(O)-100, find lim Po) A study of blood pressure and age compares the blood pressures of men in three age groups: less than 30 years, 30 to 55 years, and over 55 years. Select the best method to analyze the data. a. Wilcoxon rank sum test b. Mann-Whitney test c. Kruskal-Wallis test d. Wilcoxon signed rank test Suppose that you borrow $10,000 on a 60-month car loan at 6.25% APR. Compute the monthly payment. a. Set up an equation for the problem using the following variables: n i pv pmt fv; where n=number of periods and i= interest rate per periodWhat is the actual formula?Does this one work? Part of a homeowner's insurance policy covers one miscellaneous loss per year, which is known to have a 10% chance of occurring. If there is a miscellaneous loss, the probability is c/x that the loss amount is $100x, for x = 1, 2, ...,5, where c is a constant. These are the only loss amounts possible. If the deductible for a miscellaneous loss is $200, determine the net premium for this part of the policythat is, the amount that the insurance company must charge to break even. if the enzyme-catalyzed reaction e s es e p is proceeding at or near the vmax of e, what can be deduced about the relative concentrations of s and es What is the floor of the House and Senate chambers?1. the place in each chamber where members of Congress vote on whether bills should be laws2. the place in each chamber where members of Congress stand to talk to constituents3. the place in each chamber where members of Congress give speeches about bills4. the place in each chamber where members of Congress investigate the possible effects of a bill Minerals can be classified based on cleavage or fracture. These two properties refer to the way in which a mineral tends to break. Cleavage is an orderly breakage in well-defined planes. It means that the broken piece of mineral will have flat and smooth sides. Fracture is a random breakage. If a mineral breaks with rough, random, uneven surfaces, it is said to have fractured. Because each of your mineral samples have already been broken from another, larger piece of a mineral, you should be able to tell if it has cleavage or fractures by looking at its sides. Of your 10 minerals, identify three that experienced cleavage. a cube-shaped gray mineral with smooth faces and sharp edges,a rust-colored mineral with a rough, uneven surface In "Bowling Alone," Robert Putnam discusses the reduced amount of social activity and civic engagement among U.S. adults during the past 40 years. Democratic governance, some have argued, depends to some degree on civic engagement and the social capital that it engenders. Putnam advances a number of reasons for the decline in civic engagement or the increase in "Bowling Alone." A leading hypothesis is that television viewing a solitary activity has replaced social activity as a primary form of leisure activity. The article was written a while ago. Today, he might extend that hypothesis to include the extent to which social media replaces conversation and social activity. Building on this information, please answer the following questions.1. What is the dependent variable in the hypothesis regarding television viewing?2. What is the independent variable in the hypothesis regarding social media?3. What is the hypothesized direction of the association between the independent and dependent variable in the social media hypothesispositive, negative, null, or the direction of association cannot be determined?4. In a sentence or two, please explain your reasoning for your answer in c.5. What is the null hypothesis for the hypothesis regarding TV viewing and civic engagement? the sequence of part of an mrna transcript is 5augcccaacagcaagaguggugcccugucgaaggag3 what is the sequence of the dna coding strand? how are the shapes alikei need to know When performing a nutrition assessment, the practitioner should include what information as part of the patient's food and nutrition history? Using the article "You Trouble" discuss whether or not stunt videos cause teens to take risks and increase impulsive behavior consider the given state of stress. take a = 21 mpa and b = 45 mpa. determine the principal planes. the principal planes are at and .Determine the principal planes using Mohr's circle. a) The principal planes are at and .Determine the principal stresses using Mohr's circle. b)The minimum principal stress is MPa, and the maximum principal stress is MPa.Determine the orientation of the planes of maximum in-plane shearing stress using Mohr's circle. c) The orientation of the plane of maximum in-plane shearing stress in the first quadrant is . The orientation of the plane of maximum in-plane shearing stress in the second quadrant is .Determine the maximum in-plane shearing stress using Mohr's circle. d) The maximum in-plane shearing stress is MPa.Determine the normal stress using Mohr's circle. e)The normal stress is MPa. What are the three key components of the production process? machines, equipment, and tools purchasing, sales, and distribution testing, quality assurance, and compliancematerials, machines, and people let a2 = a. prove that either a is singular or det(a) = 1 relative to the current dsm-iv system of classifying mental disorders, the five-factor model suggests question Q#6 If a roan bull is crossed with a white cow, what percent of offspring will have a roan phenotype? 100% 753 25 SON Question 7 Q#7 Both Mrs. Smith and Mrs Jones had baby girls the same day in the same hospital. Mrs. Smith took home a baby girl, who she ca Shirley. Mrs. Jones took home a baby girl named Jane. Mrs. Jones began to suspect however, that her child and the Smith baby had accidentally switched in the nursery. Blood tests were made. Mr. Smith is Type A Mes Smith is Type B. Mr. Jones is Type A Mestone Type A. Shirley is Type O, and Jane is Type B. Had a mix-up occurred, or is it impossible to tell with the given information it is impossible to tell with the oven Information Alkup occured. The Smiths could not have had a bay with type o blood Amb up occured. The Jones could not have had a baby with Type B blood Amik up occured. Neither parents could have produced a baby with the stated blood type Question 8 Gomovies.com Q8 If a man of genotype i marries a woman of genotype what possible blood types could their children have their children could have A Bor AB blood types their children could have A st As blood types their children could have A B. ABor blood types the children could have A or blood tyres Search O 31 Question 2 of 10Which question would be most appropriate to ask yourself when consideringhow to address your audience for a procedural document?OA. What research do I need to do to understand my topic?B. Will readers respond best to a formal or informal style?OC. Why can't I find a good image to illustrate my points?OD. Where can I go for information about my topic?WSUBMIT