Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.
What do you mean by Transcription?Transcription may be defined as the process by which the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA).
Stop codons are responsible for the termination of transcription of almost all the genes. They are necessary for inhibiting the excessive expression of some genes.
Therefore, those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.
To learn more about Transcription, refer to the link:
https://brainly.com/question/1048150
#SPJ4
What is the purpose of Gram staining?
A. to determine which of three shapes the bacteria is
B. to organize bacteria into two main groups based on their cell walls
C. to kill the bacteria by putting it in a hypertonic state
D. to determine what symptoms the bacteria will cause
Hello people ~
Which of the following factors are essential to ignite a fire?
A. All of these
B. Fuel
C. Air (oxygen)
D. Heat
Answer:
All of these
Explanation:
Any fire needs three things to burn.
Fuel to keep burning.Oxygen to burnHeat until calorie value of substanceSo option A is correct
which of the following best describes the cycle of matter between humans and the environment?
A: humans exhale carbon dioxide which plants use in cellular respiration
B: humans inhale oxygen from plants which is used in cellular respiration to produce water
C: humans inhale oxygen from plants which is used in photosynthesis to produce carbon dioxide
D: humans exhale carbon dioxide which plants use in photosynthesis to produce more carbon dioxide
Answer:
B: humans inhale oxygen from plants which is used in cellular respiration to produce water
Explanation:
government and business use incentive to
Answer:
Governments and businesses use incentive to encourage or deter behaviour
Explanation:
Governments will do things like putting tax breaks on individuals to encourage them to do something, or putting additional taxes on things such as cigarettes. Employers do this through bonuses and pay cuts.
how did the white blood cell count of the abnormal blood smear differ from that of the normal blood smear
Answer: The examination focuses on the morphologies of red blood cells, white blood cells, and platelets. The percentage of each of the five types of white blood cells ...
Explanation:
Question 8: How would you describe the effect of different magnitudes of the same factor on the number of
individuals within a population? Use evidence from the graph and table (average values) to support your
answer.
THIS IS EDGE 22 please helppp
Answer:
I don't understand thequestion
what does erosion do?
A. It changes rock chemically
B.it changes rock particles into rock
C.it breaks rock down physically
D.it moves pieces of rock Please answer fast its due today
the answer to this problem is c
How do you use the Hardy-Weinberg equation formula? I am pretty confused on how to apply some of the things... Thank you in advance :)
Answer:
i dont know wether this is right answer of your question or not but here yo go
Answer:
Trust the other guy :P
Explanation:
3. Carbonation - Warmer temperatures result in more rain. Rain and carbon dioxide combine with limestone
to make calcium bicarbonate. Thus removing carbon dioxide from the atmosphere and resulting in lower
temperatures. (focus temperature)
Earth's system(s) involved
4. Global warming affects the cloud distribution, resulting in higher altitude clouds. Clouds at higher
altitudes result in more infrared radiation reflected back at the Earth's surface than immediately reflected back into
space. (focus temperature)
Earth's system(s) involved
Answer:
Warmer ocean water is involved in the cycle letter d, for the greenhouse gas and the atmospheric carbon dioxide will be able to cause a rise in the ocean temperature, causing a high increase in terms of evaporation. Thus, the vapored water will contribute to the increase of global warming.
Explanation:
hope im right
Genetic change caused by mutations in DNA can lead to?
Answer:
Sometimes, gene variants (also known as mutations) prevent one or more proteins from working properly. By changing a gene's instructions for making a protein, a variant can cause a protein to malfunction or not be produced at all.
A person who is dehydrated has a lower than normal amount of water in their blood but has the same amount of formed elements. Therefore, their hematocrit will be _____________ normal.
17. Which physical law states that all orbits are conic sections?
A. Kepler's first law
OB. Kepler's third law
O C. Newton's laws
D. Kepler's second and third laws
Answer:
Keplar's First Law
Explanation:
#PennFoster
JHMS
Where is the first place Peter Sagal visits in the video after buying his motorcycle?
2. Do you think the government goes too far in regulating the lives of Americans? Explain your answer.
3. How does Nevada (Las Vegas) demonstrate federalism?
Answer:
i dont know why ypu asking?
In the process of ————. DNA is used as a template for making another type of Nucleic acid?
Answer:
transcription, RNA
Explanation:
What part of the plant traps the energy in the sunlight as the sunlight strikes the leaves? stem roots chlorophyll stomata HURRY I WILL GIVE BRAINLEIST
Answer:
Chlorophyll
Explanation:
stomata are used for water regulation
roots absorb nutrients and water
stems provide structure
Answer:Chlorophyll
Explanation:
The process of making changes in the dna code of a living organism is called.
Should we start doing genetic testing to determine if someone is a good candidate to be a firefighter, or police officer? Why or why not?
How are antibiotics different from "classic drugs"?
Answer:
Answer at explanation part.
Explanation:
An antibiotic is a type of antimicrobial substance active against bacteria.
Classic drugs can be harmful or addicting. So antibiotics are more useful than other drugs.
Hope this helped!!!
Scientists have several theories about magma hotspots and mantle plumes. They are theories because neither can be observed within the Earth's layers. Scientists say a model of a hotspot/mantle plume location in the Earth is much like a lava lamp. Consider the photo of the lava lamp and complete the analogy. Select which description would not apply
Most Magma Hotspots are situated under the African Plate. Others occur very close to the diverging plate boundaries. Some are also known to be underneath Iceland, the Azores, and the Galapagos Islands.
What is a Magma Hotspot?A magma hot spot refers to an area on the Earth domiciled over a mantle plume where molten magma is hotter several degrees than surrounding magma.
The magma plume causes melting and thinning of the rocky crust and widespread volcanic activity.
Please note that the referenced photo is unavailable hence the general answer.
Learn more about Magma Hotspot at:
https://brainly.com/question/282583
Read the description of interphase at the bottom of the gizmo. What happens to the cell at the beginning of interphase?
Answer:
During the G1 phase, cells synthesize and grow mRNA and proteins for DNA synthesis.
Explanation:
Interphase is the resting phase of cell cycle. In this phase cell grows in size, accumulate nutrients and duplicate its genome. It also take part in mRNA and protein synthesis.
What are steps involved in cell cycle?Cell cycle is the series of events in which cell grows and duplicate to form daughter cells.
It has two phases:
Interphase: in this phase cell synthesize, grow, produce mRNA and protein and replicate cell's DNA. It is divided into: G1, S and G2 phase.M-phase: in this phase actual cell division takes place.Thus, in the beginning of interphase, cells prepare for division, accumulate nutrients and duplicate their genome.
For more details regarding cell cycle, visit:
https://brainly.com/question/15876101
#SPJ3
Why can we not see the South Pole-Aitken basin from Earth? The crater is too small to see from Earth. The moon rotates too fast to see any surface features. The crater is on the far side of the moon, which we cannot see. The sun never shines on that side of the moon, so the crater is always in shadow. Why can we not see the South Pole-Aitken basin from Earth? The crater is too small to see from Earth. The moon rotates too fast to see any surface features. The crater is on the far side of the moon, which we cannot see. The sun never shines on that side of the moon, so the crater is always in shadow
Answer:
i Believe its D. :D
Explanation:
Hope this helps :p
How is this unlike making a photocopy of the original dna molecule
Answer:
The process of DNA replication results in a copy of the original DNA molecule. True or false: DNA does not have to break apart to be copied. After DNA replication is complete, there are two new DNA molecules; one molecule has both of the original strands and one molecule has two new strands of DNA.
Explanation:
The processes of transcription and translation are critical pieces of gene expression to produce proteins in all living cells on earth.
Which statements correctly differentiate transcription and translation? More than one statement may apply.
Transcription is the process of synthesizing RNA from DNA, while translation is the process of synthesizing proteins from RNA.
Transcription involves the production of a complementary RNA copy of a DNA sequence, using RNA polymerase and nucleotides. The resulting RNA molecule, called messenger RNA (mRNA), carries genetic information from the DNA in the nucleus to the ribosomes in the cytoplasm.
Translation, on the other hand, involves the reading of the mRNA sequence by ribosomes, which assemble amino acids into a polypeptide chain according to the genetic code. This process involves transfer RNAs (tRNAs) that carry specific amino acids and match them to the codons on the mRNA. Together, transcription and translation enable the transfer of genetic information from DNA to proteins, which perform vital functions in cells.
To know more about translation, here
brainly.com/question/21440478
#SPJ1
--The complete question is, The processes of transcription and translation are critical pieces of gene expression to produce proteins in all living cells on earth. Differentiate transcription and translation?--
HELP NOW
Based on the data table What outliers are there in the experiment from the trials?
Why is it important to design field studies that will not make wild animals associate humans with food?
What percentage codes for proteins, make up our bodies
Answer:
Only 1%
Explanation:
Answer:
If you sort through the three billion letters that make up the human genome, you find some surprising things. Only about 1% of the three billion letters directly codes for proteins. Hope this helps!
Explanation:
Which statement regarding viral diseases is false? AIDS was around for decades before becoming a widespread epidemic. Very few new human diseases have originated in other animals because the genetic differences are too great. RNA viruses tend to have an unusually high rate of mutation because their RNA genomes cannot be corrected by proofreading. New viral diseases often emerge when a virus infects a new host species.
The statement 'very few new human diseases have originated in other animals because the genetic differences are too great' regarding viral diseases is false.
What is a viral disease?A viral disease is an infection caused by a virus that may be spread to cause pandemic and epidemic situations.
Viruses are non-living forms and/or entities that are present in a suitable host to reproduce and survive.
In many situations, viruses mutate in order to pass from a type of host (animal) to a human host.
Learn more about virus infections here:
https://brainly.com/question/12034274
which is the second highest in the food chain acorn squirrel crow
Answer:
Squireel
Explanation:
A person with a recessive allele for colour blind may not be colur blind explain
Answer:
color blindness is inherited as a recessive trait on the X chromosome. This is known in genetics as X-linked recessive inheritance. As a result, the condition tends to affect males more often than females
Explanation:
What is a day to day example of something that uses infrared light?
Answer:
Remote controllers or night vision security cameras
Explanation:
Hope this helps